Analyse qualitative des oligonucléotides à l'aide de l'Advion Interchim Scientific® Système HPLC-UV/MS

Instrumentation
Spécification de masse: exPression® Spectromètre de masse compact (CMS)
HPLC:AVANT®

Introduction

Les oligonucléotides ont suscité une attention considérable dans le développement biopharmaceutique en raison de leur
capacité à moduler l’expression d’un gène ou d’une protéine. Leur succès clinique est évident avec l’approbation de plusieurs médicaments à base d’oligonucléotides ou leur progression vers les essais cliniques. Ces médicaments comprennent des oligonucléotides antisens, des produits thérapeutiques à petits ARN interférents (siARN) et des vaccins à base d'ARNm, illustrés par le développement réussi des vaccins contre la COVID-19. De telles réalisations ont stimulé davantage d’intérêt et d’investissements dans la recherche et le développement des oligonucléotides.

La synthèse en phase solide est une méthode couramment utilisée pour produire des séquences oligonucléotidiques. La matière première est généralement purifiée par diverses techniques, telles que le dessalage, l'ultrafiltration, l'extraction en phase solide (SPE), la chromatographie liquide haute performance (HPLC) ou la chromatographie liquide préparative (prepLC), en fonction du niveau de pureté souhaité. Les méthodes HPLC ou prepLC par appariement d'ions sont souvent préférées car elles offrent une pureté plus élevée que les autres techniques.

Cette note d'application vise à démontrer l'analyse HPLC/UV de plusieurs échantillons d'oligo et à utiliser l'analyse HPLC/CMS pour déterminer leur poids moléculaire.

Method

Système HPLC-UV/CMS
Avec une pompe quaternaire et une vanne de sélection de colonne, le processus de commutation entre différents tampons et colonnes pour diverses analyses devient remarquablement simple, éliminant le besoin de procéder manuellement.
retirer la colonne et changer le solvant. Cette automatisation améliore considérablement l’efficacité et la commodité du processus analytique.

Tableau 1 : Liste des instruments d'articles


Amorce Oligo(dT) 12-18
L'amorce Oligo (dT) 12-18 (Thermos Fisher Scientific, MA) a été utilisée pour vérifier la méthode HPLC pour l'analyse des oligonucléotides.

La séparation de ces amorces Oligo (dT) 12-18 a été réalisée à l'aide d'une méthode HPLC en phase inverse par paire d'ions avec une colonne Interchim Uptisphere Strategy 5 µm C18HQ 250 x 4.6 mm. Une aliquote de 10 μL a été injectée pour toutes les analyses et la température de la colonne a été maintenue à 30 °C. La composition de la phase mobile A était de 100 mM de TEAA dans l'eau, tandis que la phase mobile B est de l'acétonitrile. Et le débit est de 1 ml/min.

L'analyse HPLC s'est déroulée comme suit : Après injection de l'échantillon, la phase mobile B a été fixée à 10 % pendant 1 minute. Elle a ensuite été augmentée linéairement jusqu'à 15 % sur 24 minutes. A 25.1 minutes, il est passé à 95 % et maintenu à ce niveau pendant 2.4 minutes pour nettoyer la colonne. Ensuite, à 27.6 minutes, elle a été réduite à 10 % et maintenue pendant 2.4 minutes pour l'équilibrage de la colonne.

La figure 1 montre que la méthode HPLC sépare efficacement les sept amorces Oligo(dT) 12 à 18.

Figure 1 : Analyse HPLC/UV d’Oligo(dT)12-18


Standard ARN à 4 composants
Le mélange d'oligonucléotides d'ARN (Aglient Technologies, CA) a été préparé en le diluant 10 fois avec de l'eau DI avant analyse HPLC. Les séquences de quatre normes d'ARN sont les suivantes : 14 mers (CACUGAAUACCAAU), 17 mers (UCACACUGAAUACCAAU), 20 mers (UCAUCACACUGAAUACCAAU) et 21 mers (GUCUCAUCACACUGAAUACCAAU).

La séparation de ces échantillons d'ARN a été réalisée en utilisant une méthode HPLC similaire à celle des amorces oligo (dT) 12-18, avec de légères modifications.

L'analyse HPLC s'est déroulée comme suit : Après injection de l'échantillon, la phase mobile B a été fixée à 9 % pendant 1 minute. Elle a ensuite été augmentée linéairement jusqu'à 10 % sur 24 minutes. A 25.1 minutes, il est passé à 95 % et maintenu à ce niveau pendant 2.4 minutes pour nettoyer la colonne. Ensuite, à 27.6 minutes, elle a été réduite à 9 % et maintenue pendant 2.4 minutes pour l'équilibrage de la colonne.

La figure 2 montre que la méthode HPLC sépare efficacement les quatre échantillons d'ARN, même avec une différence de 1-mer entre les échantillons d'ARN 20-mer et 21-mer. Cette séparation de base pour les 20-mer et 21-mer est cruciale pour l'analyse des oligonucléotides synthétiques, car la plupart des impuretés lors de la synthèse sont généralement N=1 mer ou N+1 mer.


Échantillons d'ADNsb
Trois échantillons d'ADN simple brin (ADNsb) avec 17 mers (GTCAGCAAGGACATCGT), 18 mers (CATTTGAGTAGCCAACGC) et 19 mers (GGACACTTTCATGCGAGTT) ont également été testés en utilisant la méthode HPLC modifiée par rapport à celle utilisée pour les échantillons d'ARN.

La concentration de chaque ADNsb était de 30 µM et des aliquotes de 10 µL ont été chargées sur la colonne pour analyse. L'analyse HPLC a été réalisée en utilisant le gradient suivant : Après l'injection de l'échantillon, la phase mobile B (MPB) a été fixée à 9 % pendant 1 minute, puis augmentée linéairement jusqu'à 15 % sur 24 minutes. A 25.1 minutes, il est passé à 95 % et maintenu à ce niveau pendant 2.4 minutes pour nettoyer la colonne. Au bout de 27.6 minutes, le MPB a été réduit à 9 %, et ce niveau a été maintenu pendant 2.4 minutes pour l'équilibrage de la colonne. Le débit pour l'analyse a été réglé à 1.5 ml/min. Malgré le changement plus important du solvant B par minute par rapport aux échantillons d’ARN, la figure 3 démontre que la méthode sépare efficacement les trois échantillons d’ADN double brin avec une bonne résolution de base.

Figure 3 : Analyse HPLC/UV de trois échantillons d'ADNsb 1-3, trois échantillons d'ADN simple brin avec ADNsb-1 : 17 mers (GTC AGC AAG GAC ATC GT) ; ADNsb-2 : 18 mers (CAT TTG AGT AGC CAA CGC) et ADNsb-3 : 19 mers (GGA CAC TTT CAT GCG AGT T).


Analyse de pureté d'un échantillon d'ADNsb
Avec une même méthode utilisée pour les échantillons d'ADNsb présentée dans la figure 3, elle a également été utilisée pour l'analyse de pureté d'un échantillon d'ADNsb : 19 mer (5'-TGGCGGGCGTACCTGGACT-3').

La figure 4 révèle que l'ADNsb 19 de 4 mers a une pureté UV de 74.3 % à 260 nm, déterminée à l'aide du logiciel Advion Data Express.


Analyse MS de l'échantillon d'ADNsb utilisé dans l'analyse de pureté F.5
L'analyse HPLC/MS des oligonucléotides a été réalisée à l'aide d'un Advion AVANT® Système HPLC couplé à un Advion ExPression® CMS-L. Pour l'analyse MS, la colonne Interchim Uptisphere Strategy 2.6 µm C18-HQ de dimensions 50 x 2.1 mm a été utilisée, avec un débit de 0.2 ml/min. La température de la colonne a été réglée à 55°C.

Par rapport à l’utilisation du TEAA pour l’analyse de masse des oligonucléotides, les réactifs à paires d’ions combinant TEA et HFIP offrent des performances considérablement améliorées. Par conséquent, cette note d’application se concentrera sur l’utilisation des réactifs de paires d’ions TEA et HFIP pour l’analyse HPLC/MS des oligonucléotides.

La phase mobile était constituée de 15 mM de TEA et de 10 mM de HFIP dans de l'eau en tant que phase mobile A et de méthanol en tant que phase mobile B. La durée totale d'exécution de la HPLC était de 25 minutes, en commençant avec 5 % de solvant B pendant 1 minute.
Le pourcentage de B a ensuite été augmenté à 6 % sur 14 minutes, suivi d'une augmentation à 95 % à 15.1 minutes qui a été maintenue pendant 2.9 minutes pour éluer les composés d'intérêt. Par la suite, le % B a été réduit à 5 % et maintenu à ce niveau pendant 6.9 minutes pour équilibrer la colonne avant l'analyse suivante.

L'analyse MS a été réalisée en mode ESI négatif avec la plage de numérisation MS définie entre 500 et 2000 5 Da. La figure 4b montre les spectres MS de l'ADNsb-1463.9, affichant une enveloppe chargée avec des pics à m/z 4 (1170.8-), 5 (975.8-), (6 (936.0-), 7 (731.8-), 8 (650.2-). ) et 9 (5861.8-). Grâce à la déconvolution de charge dans Data Express, la masse non chargée de l'échantillon d'ADN simple brin a été déterminée comme étant de 5860.8 XNUMX Da, ce qui correspond étroitement à la valeur théorique de XNUMX XNUMX Da.

Figure 5 : Analyse HPLC/MS de l'ADNsb-4 (5-TGG CGG GCG TAC CTG GAC T-3), MW 5860.8 Da


Figure 6 : Analyse HPLC/MS de l'ADNsb-5 (5-GGGTGG-CAT-TAT-GCT-GAG-T-3), mw 5914.9


Analyse MS d'un autre exemple d'échantillon
Les spectres MS de l'ADNsb-5 (5'-GGG-TGG-CAT-TATGCT-GAG-T-3') sont représentés sur la figure 6, montrant une enveloppe chargée avec des pics à m/z 1477.8(4-), 1182.1( 5-), 984.7(6-), 843.8(7-) et 738.2(8-). Par déconvolution de charge, la masse non chargée de l'ADNsb-5 a été déterminée à 5913.9, ce qui est en accord étroit avec la valeur théorique de 5914.9.

Conclusion

L’utilisation d’une colonne C5HQ de taille de particules de 18 µm couplée au réactif d’appariement d’ions TEAA (acétate de triéthylammonium) s’est avérée être une solution appropriée pour l’analyse HPLC des oligonucléotides.

Pour l'analyse MS des oligonucléotides, la même colonne C18HQ peut être utilisée avec HFIP (hexafluoroisopropanol) et TEA (triéthylamine) comme réactif d'appariement d'ions en conjonction avec un AVANT® Système HPLC-UV/CMS. Il a été prouvé que cette méthode donne des mesures de masse supplémentaires et précises des oligonucléotides.

Dans l'ensemble, en utilisant la colonne Interchim C18HQ et le réactif d'appariement d'ions approprié en combinaison avec l'AVANT® Les systèmes HPLC-UV et -CMS peuvent fournir une solution fiable pour l'analyse de la pureté et la caractérisation des oligonucléotides.

Bibliographie
Roberts, TC, Langer, R. & Wood, MJA Progrès dans l'administration de médicaments oligonucléotidiques. Nat Rev Drug Discov2020, 19, 673-694
Martina C. et.al. Oligonucléotides : tendances actuelles et applications innovantes en matière de synthèse, de caractérisation et de purification, Biotechnology J. 2020, 1900226

L'extraction, l'identification, la purification et la quantification du cyanidine-3-glucoside dans le riz noir

Instrumentation
Flash: puriFlash® 5.250, XS-Vap®
Spécification de masse : exPression® Spectromètre de masse compact (CMS)
HPLC : AVANTMC

Introduction
Le riz est l'un des aliments les plus essentiels au monde, en particulier dans les pays asiatiques. Parmi les variétés de riz pigmentées, le riz noir fait l'objet d'une attention croissante en raison de sa haute valeur nutritive et de ses propriétés bénéfiques pour la santé. Le riz noir est un riz pigmenté enrichi en anthocyanes qui contient de la cyanidine-3-glucoside (Cyn-3-Glu), de la cyanidine-3-rutinoside (Cyn-3-Rut), de la péonidine-3-glucoside (Pn-3-Glu) et d'autres anthocyanes. Le cyanidine-3-glucoside est l'anthocyanine dominante du riz noir.

Cette note d'application montre comment le cyanidine-3-glucoside est extrait du riz noir et purifié avec un système prepLC/Flash. La quantité et la pureté de Cyn-3-Glu sont mesurées à l'aide d'un étalon de référence certifié.

Method
Extraction de cyanidine-3-glucoside
Le riz noir a été acheté dans une épicerie locale, broyé en poudre fine avec un moulin à épices et extrait selon la méthode suivante :
1. 30 grammes de riz noir moulu ont été mélangés avec 200 ml de méthanol acidifié avec du HCl 1.0 N (85:15, v/v) et soniqués pendant 15 min.
2. Le mélange a été centrifugé à 7500 rpm à 4°C pendant 5 min. Le surnageant a été transvasé dans un flacon propre. Le culot a été extrait à nouveau avec 200 ml de méthanol acidifié avec du HCl 1.0 N (85:15, v/v) et soniqué pendant 15 min.
3. Le surnageant des deux extractions a été combiné et réduit à 25 ml à l'aide d'un évaporateur rotatif.
4. Une petite partie de l'extrait concentré a été diluée 10x avec de l'eau pour l'analyse HPLC/UV/MS, le reste a été chargé directement sur un système PrepLC/Flash pour la purification.

Configuration analytique HPLC/UV/MS
Tableau 1: Méthode analytique HPLC/UV/MS pour l'extrait de riz noir.

Analyse HPLC/MS analytique de l'extrait de riz noir
L'extrait concentré de riz noir a été dilué 10x avec de l'eau distillée pour l'analyse HPLC/CMS.

Avec une plage de masse de 200 à 800 Da, le chromatogramme HPLC/MS est illustré à la figure 1a. Le spectre MS moyen à partir du pic à 12.10 min est illustré à la figure 1b avec un seul ion à m / z 449.2 détecté en mode ESI positif. Le spectre MS avec CID dans la source est illustré à la figure 1c montrant un ion fragment de confirmation à m / z 287.0

Figure 1: UN). Le chromatogramme HPLC/MS d'extrait de riz noir, B). Les spectres de masse moyens de pic à 12.10 min, C). Les spectres de masse moyens du pic à 12.10 min avec CID en source à 30V.

Recherche dans la base de données MS Spectra
Grâce à la recherche dans la base de données des spectres MS dans Advion Data Express, le composé élué à 12.1 min est confirmé comme cyanidine-3-glucoside (Cyn-3-Glu).

Figure 2: Résultat de la recherche dans la bibliothèque des spectres MS moyens dans l'extrait de la figure 1c.

Le logiciel Peak Express aide à détecter d'autres anthocyanes
Le logiciel Peak Express™ implémenté dans Data Express peut déterminer dynamiquement le taux de changement d'intensité et l'écart type de tous les ions détectés et n'afficher que les ions qui dépassent un seuil prédéfini.

Peak Express™ aide à détecter un autre pic à 14.41 min dans le chromatogramme ΔIC (Figure 3b) qui est à peine indiqué dans son chromatogramme TIC (Figure 3a). Le spectre ΔS Delta avec le CID dans la source montre deux ions détectés à m/z 463.3 et 301.1.

La recherche dans la base de données du spectre MS détermine qu'il s'agit de Peonidine-3-O-glucoside (le résultat de la recherche est illustré à la figure 4).

Figure 3: UN). Le chromatogramme HPLC/MS de l'extrait de riz noir, B). Le chromatogramme ΔIC de l'extrait de riz noir C). Le spectre ΔS Delta du pic à 14.41 min avec CID en source à 30 V

Figure 4: Le résultat de la recherche de bibliothèque du spectre ΔS Delta dans la figure 3c

Analyse HPLC/UV de l'extrait de riz noir
L'extrait de riz noir a également été analysé par HPLC/UV. Deux pics d'absorption UV caractéristiques de Cyn-3-Glu à 12.01 min se trouvent à 278 nm et 518 nm (figure 5b).

520 nm est utilisé pour déclencher la collecte de fractions dans la purification avec un système PrepLC/Flash.

Figure 5: UN). Le chromatogramme HPLC/UV de l'extrait de riz noir, B). Le profil d'absorbance UV à partir du pic à 12.07 min

Méthode PrepLC pour la purification du cyn-3-glu
Tableau 2: Méthode PrepLC pour la purification de Cyn-3-Glu

Purification
Les purifications d'extrait de riz noir sont effectuées sur un Advion Interchim Scientific puriFlash® 5.250 Système PrepLC/Flash.

Les informations détaillées sur les solvants et la méthode de séparation sont répertoriées dans le tableau des méthodes. Le chromatogramme PrepLC/UV typique de l'extrait de riz noir (échantillon de 3 ml) est illustré à la figure 6.

Chaque fraction collectée est en outre analysée par HPLC-UV/MS pour confirmer l'identification et fournir une analyse de pureté supplémentaire.

Figure 6: Le chromatogramme prepLC (520 nm) de l'extrait de riz noir sur puriFlash® 5.250 Système PrepLC/Flash

Analyse HPLC/UV des fractions 2, 5 et 8
Toutes les fractions sont analysées par HPLC/UV/MS. L'analyse HPLC/MS de la fraction 1 montre une impureté avec le m/z 611, et une faible réponse UV de Cyn-3-Glu. Et les fractions 2 à 8 ont une pureté de plus de 97.6 %. Les chromatogrammes HPLC/UV des fractions 2, 5 et 8 sont utilisés comme exemples illustrés à la figure 7 avec des puretés de 97.6 % pour 2, 100 % pour les fractions 5 et 8.

À l'exception de la première fraction, toutes les fractions ont été combinées pour la siccité. Le séchage des fractions a été réalisé sur un Advion Interchim Scientific puriFlash® Système XS-Vap à température ambiante. Le poids de Cyn-3-Glu purifié à partir de 30 g de riz noir est de 25.8 mg.

Figure 7: Le chromatogramme HPLC/UV des fractions a) Fraction 2, b) Fraction 5, c) Fraction 8.

Quantification du C3G par HPLC/UV
Pour confirmer la pureté finale de l'échantillon séché, un étalon de référence certifié de Cyn-3-Glu a été utilisé pour l'analyse quantitative de Cyn-3-Glu sec afin de vérifier sa pureté. La courbe d'étalonnage HPLC de la référence Cyn-3-Glu est illustrée à la figure 8.

La quantité mesurée de Cyn-3-Glu est de 25.5 mg avec une pureté de 99.0 %.

Figure 8: Courbe d'étalonnage HPLC/UV de l'étalon de référence Cyn-3-Glu

Conclusion
Avec les méthodes HPLC/UV/MS et PrepLC développées, le Cyn-3-Glu dans l'extrait de riz noir peut être séparé, purifié et quantifié.

25.5 mg de Cyn-3-Glu ont été purifiés à partir de 30 g de riz noir avec une pureté de 99.0 %.
La combinaison d'Interchim PrepLC/Flash et d'Advion HPLC-UV/CMS est une solution simple et économique pour extraire et purifier le Cyn-3-Glu à partir d'échantillons de riz ou d'échantillons contenant du Cyn-3-Glu.

Suite à ce flux de travail général :

HPLC/CMS fournit un moyen simple pour l'identification et l'analyse de la pureté des composés cibles dans la purification de produits naturels.

Purification de peptides bioactifs à partir de mélanges complexes à l'aide du puriFlash® 5.250 PrepLC et exPression® Détecteur CMS

Instrumentation
Spécification de masse : exPression® CMS
Flash: puriFlash® 5.250 prépLC
HPLC : AVANT®

Auteur
Changtong Hao
Advion Interchim Scientifique

Introduction
Ces dernières années, les sociétés biopharmaceutiques ont de plus en plus adopté les médicaments à base de peptides/protéines en raison de leur spécificité et de leur sélectivité accrues par rapport aux médicaments traditionnels à petites molécules. Cependant, la purification des peptides/protéines au cours du processus de découverte de médicaments est cruciale pour garantir la sécurité et l'efficacité du produit final. Atteindre les niveaux de pureté les plus élevés possibles pour les composés cibles bioactifs est essentiel pour minimiser le risque de toxicité et se conformer aux normes réglementaires.

L'isolat de protéines de lactosérum, un sous-produit de la production de fromage, contient divers glycomacropeptides et deux peptides bioactifs importants, le macropeptide de caséine A (CMPa) avec un poids moléculaire (MW) de 6757 Da et le macropeptide de caséine B (CMPb) avec un MW de 6787 Da . Extraction et purification de composants individuels, tels que la caséine
macropeptide, est essentiel pour étudier leur bioactivité.

Dans cette note d'application, nous utilisons un isolat de protéines de lactosérum et deux macropeptides de caséine comme exemple pour démontrer l'isolement et la purification de composants bioactifs avec un système composé d'un puriFlash® 5.250 prepLC couplé en ligne à un exPression® Détecteur CMS. Cette combinaison offre une sélectivité et une sensibilité plus élevées par rapport aux détecteurs traditionnels tels que les UV ou l'ELSD, qui peuvent ne pas répondre efficacement aux peptides et protéines cibles bioactifs.


Advion Interchim Scientifique
puriFlash® 5.250


Advion Interchim Scientifique
exPression® CMS

Method
Préparation de l'isolat de protéines de lactosérum
• La procédure d'isolement des macropeptides de caséine utilisée dans cette application est basée sur les travaux de Tadao Saito avec quelques modifications.
• Un échantillon de 50 g d'isolat de protéines de lactosérum acheté dans une épicerie locale a été combiné avec 500 ml d'un mélange de solvants composé de 70 % d'eau et de 30 % de méthanol (v/v). Le mélange a été soniqué à 70°C pendant 90 minutes puis filtré sous pression réduite.
• Le filtrat résultant a été concentré à un volume de 300 ml en éliminant le méthanol à l'aide d'un évaporateur rotatif sous pression réduite à 40 °C. Il a ensuite été stocké à 4°C pendant une heure. Ensuite, un volume égal d'éthanol froid a été ajouté à la solution, et le mélange a été vortexé pendant 5 minutes avant d'être stocké à 4°C pendant 4 heures supplémentaires.
• Le mélange a été filtré sous pression réduite à l'aide d'un filtre de 0.5 µm. Le filtrat final a ensuite été concentré jusqu'à un volume de 50 ml à l'aide d'un évaporateur rotatif sous pression réduite.
• Une aliquote de 100 μL de l'extrait concentré a été mélangée à 900 μL de solution déionisée (DI)
l'eau pour l'analyse HPLC/MS analytique.
• Le filtrat restant a été utilisé pour la purification des peptides à l'aide du puriFlash® 5.250 Système PrepLC couplé à un exPression® Détecteur CMS.

Tableau 1: Configuration de la méthode analytique HPLC/MS

Configuration de la méthode analytique HPLC/MS
L'extrait liquide de l'isolat de protéines de lactosérum a d'abord été analysé à l'aide d'un AVANT® Système HPLC/CMS et méthode de séparation par chromatographie développée pour la colonne de 4.6 mm utilisée (tableau 1).

La figure 1a montre le chromatogramme HPLC/MS de l'extrait liquide. La moyenne des spectres MS à partir du pic à 6.44 min indique que le composé est un peptide chargé plusieurs fois avec au moins cinq masses à m / z 755.2, 849.4, 970.6, 1132.1 et 1358.6 (Figure 1b) formant un profil de charge.

Grâce à la déconvolution de charge logicielle, la masse non chargée du peptide a été déterminée comme étant de 6787.4 Da, indiquant le macropeptide B de caséine (CMPb, masse théorique de 6787 Da) (Figure 1c).


Advion Interchim Scientifique
AVANT® (U) HPLC


Figure 1: ( a ) Chromatogramme HPLC / MS d'extrait liquide d'isolat de protéine de lactosérum, ( b ) Les spectres MS moyens du pic à RT 6.44 min, ( c ) La masse déconvoluée et non chargée du pic d'élution du peptide à RT 6.44 min.


Figure 2: ( a ) Chromatogramme HPLC / MS d'extrait liquide d'isolat de protéines de lactosérum, ( b ) Les spectres MS moyens du pic à RT 11.02 min, ( c ) La masse déconvoluée et non chargée du peptide éluant à RT 11.02 min.

Les spectres MS moyens obtenus à partir du pic d'élution à 11.02 min suggèrent que le composé est également un peptide chargé plusieurs fois avec des masses à m/z 751.5, 845.4, 966.1, 1126.8 et 1352.1 (figure 2b) formant son profil de charge.

De même, la déconvolution de charge détermine la masse non chargée de ce peptide à 6755.3 Da indiquant la variante A du macropeptide de caséine, CMPa avec une masse théorique de 6755 Da (Figure 2c).


Advion Interchim Scientifique
puriFlash® 5.250, séparateur MS et exPression® CMS

Chromatographie PrepLC/MS
Dans une étape suivante, la méthode de séparation analytique a été transposée à une plus grande échelle de préparation d'un ID de colonne de 4.6 mm à un ID de colonne de 30 mm et optimisée pour la purification des deux CMP (glyco-macropeptides de caséine) sur le puriFlash® 5.250 Système PrepLC/Flash couplé en ligne à l'exPression® Détecteur CMS.

Le chromatogramme PrepLC-UV/MS de l'isolat de protéines de lactosérum est illustré à la figure 3 et les paramètres indiqués au tableau 2.

La collecte de fractions a été déclenchée sur la base du signal MS, choisi pour sa sélectivité et sa sensibilité plus élevées. XIC de 970-971 Da a été utilisé pour détecter CMPb, et XIC de 965-966 Da pour CMPa.

Le solvant organique de la combinaison des fractions 11 à 17 et de la fraction 18 à 22 a été éliminé à l'aide d'un évaporateur rotatif sous pression négative, et la solution aqueuse restante
La solution a été séchée à l'aide d'un lyophilisateur LABCONCO Freezone 2.5 L (-50 C), ce qui a donné une collection sèche de 10 mg chacun, qui a ensuite été dissoute dans 10 ml d'eau désionisée pour une analyse HPLC/UV/MS ultérieure. Les résultats de l'analyse de pureté sont présentés dans les figures 4 et 6.

Tableau 2: Configuration de la méthode PrepLC/MS


Figure 3: Le chromatogramme PrepLC-UV/MS de deux isolats de protéines de lactosérum

Résultats

Analyse de pureté du CMPb
L'analyse de pureté de CMPb dans les fractions regroupées 11 à 17 est illustrée à la figure 4. L'analyse MS montre que quatre ions majeurs ont été détectés avec m/z à 970.8, 1132.3, 1358.6 et 1968.2 (figure 4b).

Avec les spectres de masse moyens de la figure 4b, la masse non chargée du pic à 5.94 min a été déterminée comme étant de 6788.4 (CMPb, figure 4c). Cependant, l'analyse MS peut également détecter quatre composants mineurs à 6758.3, 6773.5, 6804.8 et 6868.4 Da.

La pureté UV obtenue de CMPb est de 86.7 % (figure 4d), mais, sur la base des données MS supplémentaires, la pureté du composé est en fait inférieure à celle (estimée à 80 %).

Le CMPa dans les fractions regroupées 18 à 22 a été mesuré à 94.7 % (figure 5a) sur la base de l'analyse UV de l'analyse.

L'analyse de masse non chargée déconvoluée montre la masse dominante attendue de 6756.2 de CMPa (figure 5b) et un composant mineur à 6774.6, une forme oxydée de CMPa.

Encore une fois, cet exemple montre la valeur de la détection MS de composés bioactifs tels que les peptides et les protéines, et la meilleure spécificité de la détection MS par rapport aux UV.


Figure 4: (a) Le chromatogramme HPLC-MS des fractions regroupées de 11 à 17, (b) Moyenne des spectres MS du pic éluant à RT 5.94 min, (c) la masse non chargée de (b), (d) Le chromatogramme HPLCUV des fractions regroupées du 11 au 17.


Figure 5: ( a ) Le chromatogramme HPLC-UV des fractions regroupées de 18-22. (b) masse non chargée déconvoluée de CMPa.

La pureté globale finale est estimée à env. 90 %, une excellente valeur pour une molécule bioactive dans la découverte de médicaments.

Une amélioration supplémentaire de la pureté peut être obtenue avec des fractions sélectives - au détriment du rendement. Par exemple, l'analyse HPLC-UV/MS de la fraction 20 de CMPa (Figure 6a) montre une pureté UV de 99.0 % (Figure 6d) et aucun sous-produit oxydé dans l'analyse MS.


Figure 6: ( a ) Le chromatogramme HPLC-MS de la fraction 20, ( b ) Moyenne des spectres MS du pic à RT 5.71 min, ( c ) masse non chargée déconvoluée de CMPa ( d ) Le chromatogramme HPLCUV des fractions 20.

Conclusion
Le puriFlash® 5.250 Système PrepLC/Flash, couplé en ligne avec un exPression® Le détecteur CMS atteint des performances exceptionnelles, facilitant la purification sélective de macropeptides bioactifs à partir d'une matrice complexe avec un niveau de confiance élevé. Comparé aux détecteurs UV ou ELSD, le spectromètre de masse offre une sélectivité et une sensibilité supérieures.

Une application illustrative de cette approche montre l'isolement de caséine glycol-macro-peptides, résultant en une gamme de pureté de 80% (CMPb) à 90% (CMPa) à travers des fractions combinées avec un rendement élevé. Une pureté encore plus élevée allant jusqu'à 99.0 % peut être obtenue avec des fractions sélectives.

 

Références

Gräslund, S., et al. (2008). Production et purification de protéines. Méthodes naturelles, 5(2), 135-146.
Traitement biopharmaceutique : développement, conception et mise en œuvre de procédés de fabrication.
Lin T., et al. (2021) Bioactifs dans le lait de vache : chimie, technologie et applications Nutrition Reviews v79(S2):48–69
Saito T., euh al. (1991) Une nouvelle méthode d'isolement de caséinoglycopeptide à partir de lactosérum de fromage doux. J. Dairy Sci. 74, 2831-2837

Analyse de sang à l'aide de l'Advion Interchim Scientific SOLATION® ICP-MS

Introduction

Les oligo-éléments sont essentiels au bon fonctionnement biologique chez l'homme, et différents niveaux d'oligo-éléments sont révélateurs de nombreuses maladies et affections. Des oligo-éléments non essentiels sont également présents dans le corps humain en raison de contaminants environnementaux générés par des activités humaines ou industrielles déposés dans le sol, l'air, l'eau et les denrées alimentaires. Ces oligo-éléments essentiels et non essentiels sont facilement mesurés et surveillés dans le sang, le sérum et l'urine à l'aide de l'ICP-MS.

Dans cette note d'application, nous présentons une méthode rapide pour l'analyse de routine d'échantillons de sang de petit volume pour les principaux éléments toxiques et essentiels à l'aide du SOLATION® Spectromètre de masse à plasma à couplage inductif (ICP-MS) utilisant une simple préparation d'échantillon "diluer et tirer". La sensibilité élevée et la large plage dynamique de l'ICP-MS sont particulièrement importantes pour la détermination des niveaux de traces de métaux lourds, tout en mesurant simultanément les éléments pertinents sur le plan nutritionnel à des niveaux plus élevés. Le sang est une matrice complexe, riche en protéines et en sels qui favorisent la formation d'interférences à base de carbone et de chlore qui affectent de nombreux analytes. La cellule de collision sur SOLATION d'Advion Interchim Scientific® L'ICP-MS est nécessaire pour surmonter ces interférences.

Le SOLAT® L'ICP-MS possède une cellule de collision octupôle qui est utilisée pour traiter les interférences des ions polyatomiques, en particulier pour les éléments de métaux de transition. Il est essentiel pour une analyse robuste et de routine des éléments traces que la cellule octupôle ne soit pas contaminée, ce qui pourrait entraîner une dérive et des temps d'arrêt inutiles. Les ions traversant l'interface sont dirigés à travers un virage à 90˚ et focalisés sur l'entrée de l'octupôle à l'aide d'un déflecteur quadripolaire (QD). Les particules légères et neutres continuent à travers le QD et loin de la cellule.

La cellule de collision dans la SOLATION® L'ICP-MS peut fonctionner en mode "He Gas" dans lequel la cellule est remplie d'He pour agir comme un gaz de collision, ou en mode "No Gas" dans lequel la cellule est vide. Le mode « He Gas » est utilisé pour les isotopes soumis à des interférences polyatomiques tandis que le mode « No Gas » est utilisé pour le reste des isotopes. La commutation rapide entre les modes "He Gas" et "No Gas" sur le SOLATION® (< 5 sec) garantit que les cycles d'analyse peuvent être courts, améliorant ainsi la productivité.

Expérience et résultats

Réactifs et matériaux

Acide nitrique (Aristar Plus, qualité traces de métaux)
Triton X-100 (spécialement purifié, Roche Chemical)
Eau, type 1 (18.2 MΩ, système de point d'utilisation Elga)
Méthanol (hypergrade pour LC-MS, Supelco)
Solutions étalons de Mg, Ca, Mn, Cu, As, Se, Cd, Pb, Ge, Rh, Au et Ir (1000 μg/ml, qualité Claritas ppt) 
Oligo-éléments Sang total L-1 (SRM1) (Seronorm)
Oligo-éléments Sang total L-2 (SRM2) (Seronorm)
Oligo-éléments Sang total L-3 (SRM3) (Seronorm)
Sang total blanc (WB(F)) (UTAK)
Diluant acide : (0.5 % d'acide nitrique, 0.05 % de Triton X-100, 2 % de méthanol, 0.25 μg/mL (ppm) Au et les étalons internes : 10 μg/L (ppb) Ge, Rh et Ir)

Tableau 1: Étalonnage et concentrations standard

Normes

La méthode a été développée pour déterminer Mg, Ca, Mn, Cu, As, Se, Cd et Pb dans des échantillons de sang total. Les éléments ont été choisis pour représenter certains des métaux couramment mesurés dans le sang, couvrant à la fois les éléments essentiels et toxiques. Les étalons ont été préparés en utilisant le diluant acide avec des éléments à quatre niveaux de concentration pour couvrir la gamme généralement observée dans le sang. Le tableau 1 présente les concentrations standard à chaque niveau et les éléments qui se trouvent à ce niveau. Le mode d'analyse et l'étalon interne utilisés pour chaque analyte figurent dans le tableau 2. Les directives de l'ICH exigent un minimum de cinq concentrations pour établir la linéarité ; avec le blanc d'étalonnage, nous en utilisons six, satisfaisant à cette exigence.

Tableau 2: Mode d'analyse et étalons internes

Échantillons et préparation

Les échantillons ont été préparés dans des tubes à centrifuger sans métal de 15 ml. Un diluant acide (14.7 ml) a été ajouté à chaque tube, suivi d'un échantillon de sang de 0.3 ml pour une dilution de 1:50. Les tubes ont été bouchés et retournés 3 à 5 fois pour bien mélanger.

Les échantillons ont été analysés à l'aide d'un SOLATION® ICP-MS. La SOLATION® La configuration de l'instrument pour cette analyse était une chambre de nébulisation cyclonique avec un nébuliseur concentrique Micromist et une torche monobloc. Des cônes d'échantillonnage et d'écumage de Ni ont été utilisés tout au long de l'étude. Les conditions de fonctionnement de l'instrument sont résumées dans le tableau 3.

Tableau 3: Paramètres de fonctionnement ICP-MS

Résultats et discussion

Nous avons suivi les directives ICH "Validation of Analytical Procedures" pour la validation des méthodes qui définissent les exigences spécifiques en matière d'exactitude, de précision (répétabilité), de limite de détection et de limite de détection de la méthode (DL et MDL) et de limites de quantification (LOQ). 

La précision de la méthode a été établie à l'aide des matériaux de référence Seronorm, qui avaient des valeurs de concentration certifiées pour tous les éléments de la méthode. Ces matériaux ont été mesurés en triple et les résultats analytiques ont été comparés aux valeurs certifiées et aux limites de confiance à 95 % fournies par Seronorm. 

Ces valeurs sont tracées sur la figure 1 où les valeurs minimales et maximales certifiées sont représentées sous forme de boîte. Nos valeurs analytiques sont tracées dans la figure 1, et dans chaque cas, nos valeurs se situent à l'intérieur des limites indiquant un haut degré de précision qui répond facilement aux spécifications ICH.

Une deuxième mesure de précision est la récupération des pointes. L'échantillon de « sang blanc » (WB(F)) de l'UTAK a été dopé avec 150 μL de la solution étalon mère pour tous les éléments sauf Ca et Mg dans le tube de 15 mL. La récupération est calculée comme suit : 

Les récupérations de dopage sont présentées dans le tableau 4. Toutes les récupérations se situent entre 90 et 110 %, ce qui indique une excellente récupération des analytes dopés.

Tableau 4: Récupérations de pics

La précision de la méthode est mesurée par la répétabilité de six échantillons de niveau séronorme 2 (SRM2). Six échantillons de Seronorm niveau 2 (SRM2) ont été préparés, dilués et analysés individuellement. Les résultats montrent moins de 3 % de RSD parmi les répliques. Le % RSD des six répliques est présenté à la figure 2.


Figure 1: Précision de l'analyse des matériaux certifiés Seronorm


Figure 2: Précision de l'analyse des matériaux Seronorm

La limite de détection de la méthode (MDL) et la limite de quantification (LOQ) ont été déterminées à l'aide de l'écart type (σ) du signal de huit blancs de diluant acide. Les blancs de diluant acide ont été préparés en utilisant la même technique et le même équipement que les échantillons et ont été inclus à la fin de chaque analyse, suivis d'un standard d'étalonnage. La MDL et la LOQ sont calculées comme suit : 

où S est la pente d'étalonnage, et :

Étant donné que la pente d'étalonnage était l'analyte par rapport à un étalon interne, l'étalon d'étalonnage a été utilisé pour déterminer les coups/seconde/ppb. Ces valeurs sont calculées, multipliées par 50 pour tenir compte du facteur de dilution et exprimées en μg/L (ppb). Dans le tableau, la MDL et la LOQ sont tracées par rapport aux valeurs normales physiologiques représentées par Seronorm 2 (SRM2). Pour la plupart des analytes, la MDL et la LOQ sont minuscules en comparaison, en particulier pour les éléments majeurs que sont le calcium et le magnésium. Cependant, même pour les analytes plus difficiles tels que le sélénium, le MDL est d'un ordre de grandeur inférieur à Seronorm 2 (SRM2) qui, bien qu'étant de niveau 2 (SRM2), a la teneur en sélénium la plus faible de ces trois SRM. 


Figure 3: LOQ et MDL par rapport aux valeurs normales physiologiques
*tel que représenté par Seronorm L2, formulé pour représenter des valeurs humaines typiques ou moyennes.

Conclusion

Dans cette note d'application, nous rendons compte de l'analyse des oligo-éléments dans le sang à l'aide de l'Advion Interchim Scientific SOLATION® ICP-MS. Le sang est une matrice complexe et exigeante. Cependant, ces données appuient l'utilisation d'une méthode de préparation d'échantillon simple «diluer et tirer» qui donne des concentrations exactes et précises pour les éléments à haut niveau et à l'état de traces dans le sang. D'excellentes récupérations ont été observées pour les échantillons dopés et les MRC. La combinaison du déflecteur quadripolaire et de la cellule de collision minimise la dérive et assure l'exactitude et la précision dans le temps. La méthode rapportée bénéficie des capacités de commutation de gaz de la cellule de collision rapide de la SOLATION® pour analyser un large éventail d'éléments dans le sang pour des résultats rapides, précis et reproductibles.

Analyse d'Iohexol à l'aide de l'HPLC Advion Interchim Scientific AVANT™ et exPression® Système CMS

Introduction

L'iohexol est un agent d'imagerie non ionique largement utilisé qui améliore le contraste pour l'analyse aux rayons X. Sa faible osmolalité permet une clairance rapide par le rein, empêchant la réabsorption et la métabolisation ultérieure . Cela fait de l'iohexol un composé avec un meilleur profil d'innocuité par rapport aux autres agents d'imagerie . 

Dans de nombreuses applications d'imagerie clinique, des agents d'imagerie/agents de contraste sont administrés aux patients pour améliorer le contraste et la résolution spatiale du balayage. En raison de la toxicité et des effets secondaires de l'agent d'imagerie, les préparations de leurs concentrations connues et leur analyse de pureté sont très importantes pour leur utilisation sûre et leur diagnostic précis. 

Dans cette note d'application, une méthode HPLC-CMS simple et précise pour l'analyse des iohexols est présentée.

Method

Configuration de la méthode

Tous les solvants utilisés dans l'application étaient de qualité HPLC.

Deux étalons Iohexol ont été obtenus auprès de Sigma Aldrich.

L'un était un matériau de référence certifié d'une pureté de 99.99 %, le second avait une pureté déclarée ≥ 95 %.

Toutes les expériences ont été réalisées sur un Advion Interchim Scientific exPression® Spectromètre de masse compact couplé à un système UHPLC AVANT™ avec des paramètres comme indiqué dans le tableau 1.

Tableau 1: Méthode HPLC/MS

Analyse HPLC/UV/MS de l'Iohexol

À température ambiante, l'iohexol s'isomérisera avec deux pics détectés dans son analyse HPLC/UV/MS. 

Ces deux pics (figure 1A) proviennent d'une rotation entravée du groupe anilide N-acétyle en raison des atomes d'iode volumineux attachés au cycle benzénique central de l'iohexol. Ces deux composés sont essentiellement des "isomères de rotation" qui s'échangent lentement à température ambiante en solution aqueuse.

Les deux pics sont confirmés par analyse MS pour montrer le même m/z à 821.9 (Figure 1B et 1C) et aucune différence n'était visible dans leurs spectres de masse CID en source (Figure 2A et 2B). 

Étant donné que les deux rotamères contribuent à la toxicité des composés et aux capacités d'amélioration de l'imagerie dans l'analyse aux rayons X, la somme des deux pics sera utilisée pour toute autre analyse d'iohexol dans cette note d'application. 


Figure 1: (A) Chromatogramme HPLC (254 nm) de l'iohexol, (B) Le chromatogramme ionique d'extraction de l'iohexol protoné à m/z 821.8, (C) La moyenne des spectres MS à partir du pic à RT 4.06 min.


Figure 2: (A) La moyenne des spectres de masse CID dans la source à partir du pic à RT 3.61 min, (B) La moyenne des spectres de masse CID dans la source à partir du pic à RT 4.06 min.

Détermination de la pureté par analyse HPLC/UV

En comparant la réponse HPLC de l'échantillon d'iohexol à la réponse de l'étalon certifié iohexol à une concentration similaire, le rapport de surface de pic de l'échantillon à l'étalon certifié peut fournir une analyse rapide de la concentration et de la pureté. 

L'équation pour calculer le rapport de concentration de l'iohexol est présentée ci-dessous :

Les chromatogrammes HPLC de l'échantillon d'iohexol et de la référence certifiée sont illustrés aux figures 3A et 3B.

La valeur moyenne des deux zones de pic additionnées est de 714 pour l'échantillon d'iohexol (figure 3A) et de 740 pour l'étalon de référence d'iohexol (figure 3B). Avec le calcul du rapport de concentration, la concentration calculée d'iohexol dans l'échantillon est de 0.0964 mg/ml, ce qui équivaut à une pureté de 96.4 % - conformément à la pureté du produit indiquée de ≥ 95 %.


Figure 3: (A) chromatogramme HPLC (254 nm) de l'échantillon d'iohexol (0.1 mg/ml) (B) chromatogramme HPLC (254 nm) de l'étalon de référence iohexol (0.1 mg/ml).

Quantification par analyse HPLC/UV

Pour vérifier plus précisément la pureté d'un échantillon d'iohexol, une courbe d'étalonnage du matériau standard certifié iohexol a été créée avec cinq niveaux de dilution différents de 25 à 500 μg/mL et avec des injections en triple pour chaque concentration. La valeur R au carré de la fonction d'étalonnage linéaire résultante est de 0.9999 (Figure 4) montrant une excellente linéarité. 

Au moyen de l'approche de la courbe d'étalonnage de l'iohexol, la pureté de l'échantillon d'iohexol a été déterminée comme étant de 97.5 %. 

Cette valeur est également juste au-dessus de la pureté indiquée de min 95 % de l'échantillon et ne diffère que de 1.1 % de la valeur mesurée par l'analyse directe du rapport de réponse UV de l'échantillon d'iohexol à l'étalon de référence d'iohexol.

La détermination de la pureté au moyen d'une fonction d'étalonnage ou par analyse directe du rapport de réponse UV peut être utilisée pour les produits chimiques organiques avec des absorbances UV si un matériau standard de référence certifié est disponible.

La méthode de la fonction d'étalonnage fournira une mesure plus précise.


Figure 4: Courbe d'étalonnage de l'iohexol par chromatogramme HPLC (254 nm)

Conclusion

Le système Advion Interchim Scientific AVANT ™ (U) HPLC peut fournir des méthodes chromatographiques précises pour l'analyse de la pureté des agents d'imagerie, comme indiqué pour l'iohexol. Couplage UHPLC avec Advion Interchim Scientific exPression® Le spectromètre de masse compact fournit non seulement des confirmations des composés cibles via leur masse et modèle de fragmentation à la source, mais permet également une détermination rapide des impuretés. 

Références
T. Almen, Développement de produits de contraste non ioniques., Invest. Radiol. (1985) Radiologie d'investigation. 1985, 20(1), S2-S9.
RD Moore, EP Steinberg, NR Powe, RI White, JA Brinker, EK Fishman, SJ Zinreich, CR Smith, Fréquence et déterminants des effets indésirables induits par les produits de contraste à haute osmolalité., Radiologie. 1989, 170, 727-32.

Extraction et purification de 3 curcuminoïdes à partir de poudre de curcuma

Instrumentation:
Flash: puriFlash® XS520
CCM : Assiette Express Lecteur de plaque TLC
Spécification de masse : exPression® Spectromètre de masse compact
Échantillonnage: au plus vite® Sonde d'analyse directe

Introduction

Les curcuminoïdes sont des composés polyphénoliques naturels dérivés de la racine de curcuma (Curcuma longa). On rapporte qu'ils ont des activités antioxydantes1. La curcumine est le principal curcuminoïde présent dans le curcuma. Il est couramment utilisé comme ingrédient dans les compléments alimentaires et les cosmétiques, comme arôme dans les plats culinaires et comme colorant alimentaire jaune-orange.

Dans cette note d'application, une méthode pour séparer et purifier 3 curcuminoïdes de la poudre de curcuma en utilisant la chromatographie flash avec le Advion Interchim Scientific puriFlash® XS520 Plus, TLC avec spectrométrie de masse avec le lecteur de plaques Plate Express™ TLC et exPression® CMS est démontré. Les fractions ont été identifiées à l'aide de la sonde d'analyse des solides atmosphériques (ASAP®).

Extraction de curcuminoïdes

La poudre de curcuma a été pesée (57.3 g) et transférée dans une bouteille en verre à large ouverture. De l'éthanol (250 ml, 200 proof) a été ajouté à la bouteille et le mélange a été agité pendant 18 heures tout en étant recouvert d'une feuille. Les composés d'intérêt sont sensibles à la lumière. La bouillie a ensuite été filtrée et le filtrat a été concentré à sec pour former une huile ambrée (6.4 g).

Figure 1: Structures des curcuminoïdes.

Figure 2: Poudre de curcuma achetée en magasin (à gauche) et huile d'extrait brut (à droite).

Analyse CCM/SM

L'Advion Interchim Scientific Plate Express™ associé à l'exPression® Le CMS permet une identification facile des taches sur les plaques TLC sans avoir besoin de purification ou de préparation d'échantillon (Figure 3).

L'analyse TLC initiale a montré 4 points (dichlorométhane : méthanol, 97 : 3). Les trois taches inférieures étaient hautement fluorescentes, comme prévu pour les curcuminoïdes d'intérêt. Les spots TLC ont été analysés par ionisation APCI en mode ions négatifs. Les 3 taches inférieures ont été caractérisées par spectrométrie de masse.

Figure 3: Advion Interchim Scientific exPression® Lecteur de plaques CMS et Plate Express™ TLC (à gauche) et gros plan de la tête d'extraction de plaques TLC (à droite).

Figure 4: Plaque TLC développée visualisée à 365 nm. Spectres de masse résultants du curcumin (en haut), de la déméthoxycurcumine (au milieu) et de la bisdéméthoxycurcumine (en bas).

Épuration éclair

Une méthode isocratique a été utilisée car la séparation montrée sur TLC était optimale telle quelle. Le matériau brut a été purifié sur une colonne de gel de silice sphérique de 25 g, 15 μm (PF-15SIHC-F0025). Un poids brut de 64 mg a été chargé à sec sur 500 mg de gel de silice et chargé dans une cartouche de charge sèche de 4 g (PF-DLE-F0004).

Figure 5: Chromatogramme flash résultant de la plaque TLC développée.

Identification des fractions par ASAP®/CMS

Le EXPression® CMS avec l'ASAP® La sonde d'analyse directe permet une identification facile des composés sans avoir besoin de LC/MS ou de préparation d'échantillon.

Les fractions pures (1.1, 1.3 et 1.5) ont été analysées à l'aide de l'ASAP® sonde avec ionisation APCI et polarité positive CMS. Les curcuminoïdes s'ionisent bien en polarité APCI positive et négative, cependant (M + H)+ les ions ont montré moins de fragmentation. Les masses détectées sont cohérentes avec les [M+H] théoriques+ valeurs m/z.

Figure 6: Advion Interchim Scientifique ASAP® La sonde d'analyse directe est insérée directement dans la source d'ions compatible APCI de l'exPression® CMS.

Figure 7: Spectres de masse des fractions.

Les fractions purifiées ont été concentrées à sec pour donner respectivement les solides I (14.1 mg), II (5.6 mg) et III (6.7 mg) qui représentent la curcumine (I), la déméthoxycurcumine (II) et la bisdéméthoxycurcumine (III) à 53.4%, 21.2 % et 25.3 % du profil curcuminoïde isolé. Ces résultats sont cohérents avec les valeurs rapportées dans la littérature2.

Confirmation de la pureté du composé par RP-HPLC

Figure 8: Balayage UV du mélange de fractions purifiées.

La chromatographie liquide à haute performance en phase inverse (RP-HPLC) permet une confirmation séparée de la pureté du composé après la chromatographie flash. Un mélange égal des trois composés a été combiné et exécuté sur un Phenomenex Kinetex® 5 μm Colonne de biphényle 100 Å 50 x 2.1 mm utilisant ACN:eau isocratique (v:v, 55:45) avec 0.2 % d'acide formique. Comme prévu, l'ordre d'élution des trois curcuminoïdes a changé d'ordre avec maintenant l'élution III, II et I (Figure 8). Après avoir développé cette méthode, la fraction collectée unique respective a été injectée et analysée pour la pureté et à nouveau confirmée par analyse MS.

Figure 9: Balayage UV et spectre de masse de la fraction de curcumine 1.1.

Figure 10: Balayage UV et spectre de masse de la fraction de curcumine 1.3.

Figure 11: Balayage UV et spectre de masse de la fraction de curcumine 1.5.

Conclusion

Grâce à une combinaison de support de chromatographie TLC, de chromatographie flash et de spectrométrie de masse à différentes étapes du processus (identification de plaque TLC, confirmation de fraction et analyse de pureté secondaire), nous pouvons purifier les curcuminoïdes à partir de poudre de curcuma à des niveaux de pureté confirmés > 95 %.

Références:
1Jayaprakasha et al. Activités antioxydantes de la curcumine, de la déméthoxycurcumine et de la bisdéméthoxycurcumine. Chimie alimentaire, volume 98, numéro 4, 2006, pages 720-724. ps://doi.org/10.1016/j.foodchem.2005.06.037.
2Praveen et al. Approche RMN Facile pour le profilage des curcuminoïdes présents dans le curcuma, Food Chemistry, Volume 341, Part 2, 2021, 128646, https://doi.org/10.1016/j. foodchem.2020.128646.

Analyse de sol à l'aide de l'Advion Interchim Scientific SOLATION® ICP-MS

Introduction

Les contaminants environnementaux générés par les activités humaines ou industrielles se retrouvent souvent dans le sol via les eaux de ruissellement ou les dépôts atmosphériques. Ces contaminants peuvent être absorbés par les plantes et remonter la chaîne alimentaire, entraînant des impacts potentiellement importants sur la santé humaine et animale. Par conséquent, il est non seulement important de surveiller les niveaux de nutriments essentiels dans le sol qui sont essentiels à une croissance saine des plantes, mais il est également impératif que les niveaux de contaminants soient surveillés.

Dans cette note d'application, nous présentons une méthode d'analyse de routine de 21 éléments à l'aide de la SOLATION® Spectromètre de masse à plasma à couplage inductif (ICP-MS). Un groupe d'échantillons de sol inconnus et un CRM ont été digérés à l'aide de l'EPA 3051a et analysés selon les exigences de la méthode 6020a.

Expérience

Réactifs et matériaux
• Acide nitrique (Aristar Plus, qualité traces de métaux)
• Acide chlorhydrique (Aristar Plus, qualité traces de métaux)
• Eau, type 1 (18.2 MΩ, système de point d'utilisation Elga ou équivalent)
• NIST CRM2706 "New Jersey sol, matières organiques et oligo-éléments"
• Solution multi-éléments Spex 'CL-ICV-1'
• Solution étalon aluminium (1000 μg/ml, grade Claritas ppt)

Instrumentation
1. Anton Paar Multiwave 5000 avec le rotor 20SVT50 (20 positions, récipients de 50 ml qui s'éventent à 40 bar (580 psi)
2. Meuleuse multifonctions haute vitesse OKF
3. Advion Interchim Scientifique SOLATION® ICP-MS

Normes

Les étalons de calibration ont été préparés dans les mêmes proportions d'acide que les échantillons digérés (9mL HNO3+ 3mL HCl, ou 3:1). Un litre de 3% HNO3+ 1% HCl a été fabriqué comme diluant pour les standards, pour la dilution finale des échantillons et pour être utilisé comme blanc d'étalonnage.

Les étalons ont été élaborés à l'aide de la solution multi-éléments Spex 'CL-ICV-1' et de l'étalon aluminium à élément unique. L'aluminium a été ajouté séparément au mélange pour tenir compte des niveaux élevés de cet élément dans le sol.

Échantillons et préparation

Quatre échantillons de sol ont été séchés à 60 °C pendant une nuit, puis finement broyés à l'aide d'un broyeur multifonctions à grande vitesse OKF pour obtenir un mélange homogène. Conformément à la méthode EPA 3051a «Digestion acide assistée par micro-ondes des sédiments, des boues et des sols», 0.5 g de chaque échantillon ont été transférés dans des récipients à micro-ondes et mélangés avec 9 ml d'acide nitrique et 3 ml d'acide chlorhydrique. Les récipients ont ensuite été bouchés et exécutés en utilisant la méthode décrite dans le tableau 1. Après digestion, les échantillons ont été filtrés, portés au volume avec de l'eau déminéralisée dans un volumétrique de 50 ml. Une aliquote de 1.0 ml a ensuite été diluée à un volume final de 50 ml avec le diluant préparé pour une dilution finale nominale de 5,000 XNUMXx en fonction du poids initial de l'échantillon.

Tableau 1: Programme de digestion par micro-ondes.

Aux fins du CQ, les quatre échantillons de sol inconnus ont été préparés sous forme d'échantillon, de duplicata et de dopage. Ils ont été digérés indépendamment où les deux premiers ont été utilisés pour comparer la répétabilité de la préparation de l'échantillon, tandis que le troisième a été dopé avant la digestion pour établir la récupération de l'analyte de la procédure de digestion.

Pour vérifier l'exactitude des résultats, nous avons inclus le matériau de référence standard, NIST 2706 "New Jersey soil, organics and oligo elements", qui comprend des valeurs certifiées pour tous les analytes rapportés dans cette étude.

Les échantillons ont été analysés à l'aide d'un SOLATION® ICP-MS. La SOLATION® la configuration de l'instrument pour cette analyse était une chambre de nébulisation cyclonique avec un Micromist® nébuliseur concentrique et une torche monobloc. Des cônes d'échantillonnage et d'écumage de Ni ont été utilisés tout au long de l'étude. Les paramètres de fonctionnement du plasma étaient :

Tableau 2: Paramètres de fonctionnement du plasma.

Méthode ICP-MS

Partie intégrante de la SOLATION® L'ICP-MS est une cellule de collision octupôle utilisée pour traiter les interférences des ions polyatomiques, en particulier pour les éléments de métaux de transition. Il est essentiel pour une analyse robuste et de routine des éléments traces que la cellule octupôle ne soit pas contaminée, ce qui pourrait entraîner une dérive et des temps d'arrêt inutiles. Par conséquent, le chemin ionique de la SOLATION® L'ICP-MS a été conçu pour avoir la cellule de collision hors de la ligne directe du plasma. Les ions traversant l'interface sont dirigés à travers un virage de 90 ̊ et focalisés sur l'entrée de l'octupôle à l'aide d'un déflecteur quadripolaire (QD). Les particules légères et neutres continuent à travers le QD et loin de la cellule.

La cellule de collision dans la SOLATION® L'ICP-MS peut fonctionner en mode "He Gas" dans lequel la cellule est remplie d'He pour agir comme un gaz de collision, ou en mode "No Gas" dans lequel la cellule est vide. Le mode « He Gas » est utilisé pour les isotopes soumis à des interférences polyatomiques tandis que le mode « No Gas » est utilisé pour le reste des isotopes. La commutation rapide entre les modes "He Gas" et "No Gas" sur le SOLATION® (< 5 sec) garantit que les cycles d'analyse peuvent être courts, améliorant ainsi la productivité.

Le débit d'hélium utilisé pour le mode "He Gas" dans cette application était de 6 ml/min. Le tableau 3 répertorie les éléments utilisés pour cette analyse et leurs isotopes, ainsi que le mode utilisé pour chacun.

Tableau 3: Une liste des éléments inclus dans cette étude avec leurs isotopes et le mode gaz utilisé pour l'analyse.

Résultats et discussion

Les résultats résumés dans la figure 1 montrent un excellent accord entre les données mesurées pour CRM2706 et les niveaux extraits rapportés pour ces éléments. Une récupération légèrement plus élevée a été observée pour K et Al, peut-être en raison de la variabilité de l'efficacité d'extraction de cette méthode de digestion.

Figure 1: Données de récupération de matériau de référence certifiées.

Comme le montre le tableau 4, les récupérations de dopage se situaient en moyenne entre 75 % et 125 % pour tous les éléments, à l'exception de Al ; Cela était probablement dû à la petite taille de la pointe par rapport aux niveaux d'Al dans les échantillons. Le même tableau contient les résultats des digestions/analyses en double pour ces éléments. En moyenne, les doublons étaient séparés de moins de 20 %, la plupart des éléments présentant une excellente répétabilité de <5 %.

Tableau 4: Récupérations moyennes des pointes et répétabilité dupliquée pour les différents échantillons.

Résumé

Dans ce dossier d'application, nous rendons compte de l'analyse des éléments traces dans le sol à l'aide de l'Advion Interchim Scientific SOLATION® ICP-MS. D'excellentes récupérations ont été observées pour les échantillons dopés et les MRC. La combinaison du déflecteur quadripolaire et de la cellule de collision minimise la dérive et assure l'exactitude et la précision dans le temps. La méthode rapportée bénéficie des capacités de commutation de gaz de la cellule de collision rapide de la SOLATION® pour analyser une large gamme d'éléments dans le sol pour des résultats rapides, précis et reproductibles.

Collecte de fractions dirigées vers la masse de produits naturels : exemples d'extraits de curcuma et de thé vert

Flash : purFlash® 5.250
Spéc. de masse : exPression® CMS
Échantillonnage : dès que possible® sonde

Introduction

La chromatographie flash utilise traditionnellement l'absorption UV comme principale méthode de détection des composés au cours d'un processus de purification. Alors que l'absorption UV est largement applicable à de nombreuses classes de composés, elle a une spécificité limitée aux composés individuels dans un mélange et manque des classes de composés qui ne portent pas de chromophores.

La collecte de fractions dirigée par la masse donne aux utilisateurs la possibilité de collecter des fractions basées sur la détection par spectrométrie de masse (MS) qui est basée sur des ions spécifiques à des composés individuels et fournit des informations moléculaires spécifiques. Cela permet une simplification du processus de purification global et une plus grande confiance dans l'identité de chaque composé isolé.

Nous décrivons ici des méthodes d'isolement de produits naturels à partir de thé vert et de poudre de curcuma par collecte de fractions dirigées vers la masse pendant la chromatographie flash et la LC préparative. À des fins de démonstration, les composés isolés ont ensuite été confirmés par Atmospheric Solids Analysis Probe (ASAP®) MS ou HPLC-MS.

Introduction aux curcuminoïdes

La curcumine est le principal curcuminoïde présent dans la racine de curcuma (Curcuma longa). Il est couramment utilisé comme ingrédient dans les compléments alimentaires et les cosmétiques, comme arôme dans les plats culinaires et comme colorant alimentaire jaune-orange. Les curcuminoïdes ont été signalés comme ayant des activités antioxydantes et anti-inflammatoires.

La poudre de curcuma achetée en magasin (57.3 g) a été extraite dans de l'éthanol, puis filtrée à travers du papier filtre et concentrée. Cela a donné une huile d'extrait brut de 6.4 g contenant les trois curcuminoïdes d'intérêt (comparer également l'analyse TLC à la figure 4).


Figure 1: Structures des curcuminoïdes d'intérêt.


Figure 2: Poudre de curcuma du commerce.


Figure 3: Extrait brut d'huile de poudre de curcuma.


Figure 4: Analyse CCM à 365 nm d'extrait de curcuma (97:3 DCM:MeOH) et le chromatogramme de la méthode transféré sur le puriFlash® 5.250 en utilisant la détection UV.

Développement de méthodes

L'extrait de curcuma a d'abord été analysé sur plaque TLC puis la méthode transférée sur le puriFlash® Système 5.250 utilisant la détection UV à deux longueurs d'onde. Quatre composés ont été détectés à 254 nm avec trois curcuminoïdes supposés détectés à 427 nm, cependant, il n'y a pas de spécificité pour les composés individuels dans la détection UV.

Une méthode isocratique (97:3 dichlorométhane:méthanol) a été utilisée car la séparation montrée sur TLC était optimale. Le matériau brut a été purifié sur une colonne de gel de silice sphérique de 12 g et 15 μm (PF-15SIHC-F0012). Un poids brut de 32 mg a été chargé à sec sur 250 mg de gel de silice et chargé dans une cartouche de charge sèche de 4 g (PF-DLE-F0004). Les fractions ont été recueillies à l'aide des canaux XIC pour chaque composé d'intérêt.


Figure 5: Capture d'écran de la méthode de chromatographie flash exécutée avec des paramètres.

Les paramètres du spectromètre de masse sont contrôlés via InterSoft®Logiciel X sur le puriFlash® système. Le spectromètre de masse était équipé d'une source APCI et fonctionnait en mode d'acquisition par ionisation négative.


Figure 6: Capture d'écran des paramètres du spectromètre de masse pour la chromatographie.

Expérience

Collecte de fractions dirigée en masse

Le chromatogramme ionique extrait (XIC) créé en traçant l'intensité du signal observé à une valeur masse-charge choisie. Cela permet un signal à faible bruit des composés d'intérêt. Ici, les canaux XIC sont réglés pour détecter les trois curcuminoïdes d'intérêt.


Figure 7: Analyse TLC de l'extrait de curcuma (97:3 DCM:MeOH) et chromatogramme de la méthode transférée sur le puriFlash® 5.250 en utilisant la détection MS XIC.




Figure 8: Les spectres de masse pour chaque pic tels que fournis par le puriFlash® Intersoft®Logiciel X.

au plus vite® Confirmation des fractions MS

Les fractions pures (1.1, 1.2 et combinées 1.3 et 1.4) ont également été analysées à l'aide d'ASAP® polarité négative SM. Les masses détectées sont cohérentes avec les valeurs [MH]-m/z théoriques.




Figure 9: Les spectres de masse des composés isolés confirmant leur identité et leur pureté.

Introduction, Catéchines de thé vert

Le thé vert sec se compose généralement de 10 à 30 % de polyphénols sur la base du poids sec, les catéchines étant les principaux polyphénols du thé, notamment : (−)-épigallocatéchine (EGC), (−)-épigallocatéchine-3-gallate (EGCG), (−) -épicatéchine-3-gallate (ECG) et gallate de (−)-gallocatéchine (GCG). L'EGCG est la catéchine la plus abondante et biologiquement active, séparer et purifier les catéchines de l'extrait de thé brut peut augmenter considérablement leur disponibilité et leur valeur sur le marché.

Les feuilles de thé vert sèches ont été extraites dans de l'eau chaude, puis partagées avec de l'acétate d'éthyle, filtrées sur du papier filtre et évaporées pour donner un extrait brut. L'extrait sec a ensuite été dissous dans 7.5 ml d'eau et filtré avec un filtre de 0.2 μm avant un traitement ultérieur.


Figure 10: Infusion de feuilles de thé vert.


Figure 11: catéchines majeures du thé vert.

Développement de méthodes
Avec l'analyse HPLC-UV/MS, EGC, EGCG, GCG, EC et ECG sont détectés dans l'extrait de thé (Figure 12).

Solvant A : eau
Solvant B : Méthanol
UV : 275 nm
MS : analyse complète de 150 à 900
Colonne : US15C18HP-250/046


Figure 12: Le chromatogramme HPLC-UV de l'extrait de thé vert, les données MS et un standard pour l'EGCG ont été utilisés pour la confirmation du composé (données non présentées).

Les paramètres du spectromètre de masse sont contrôlés via InterSoft®Logiciel X sur le puriFlash® système. Le spectromètre de masse était équipé d'une source ESI et fonctionnait en mode d'acquisition par ionisation négative.


Figure 13: Capture d'écran des paramètres du spectromètre de masse pour la chromatographie.

Collecte de fractions dirigée en masse
Ici, les canaux XIC sont réglés pour détecter les 4 catéchines d'intérêt. L'EGCG et le CGC sont des isomères et partagent donc la même masse.


Figure 14: Chromatogramme de la méthode transféré sur le puriFlash® 5.250 en utilisant la détection MS XIC.


Figure 15: Les spectres de masse pour chaque pic tels que fournis par InterSoft®Logiciel X.

Conclusion

• Avec l'isolement des produits naturels, l'un des plus grands défis est l'identification des composés d'intérêt dans les mélanges d'extraits complexes.
• En utilisant la SM et la chromatographie en tandem, nous pouvons séparer et identifier les composés dans un mélange complexe avec un haut degré de pureté et de précision sans avoir besoin d'une identification supplémentaire des fractions collectées.
• Les fractions collectées peuvent être caractérisées directement à travers les données MS fournies par InterSoft®Logiciel X sur le puriFlash® systèmes.
• Le puriFlash® 5.250 et exPression® CMS forme un duo puissant dans la purification et l'identification de produits naturels tels que les catéchines présentes dans le thé vert et les curcuminoïdes présents dans le curcuma.

Purification à haut débit de cinq composés de médicaments en vente libre et sur ordonnance par LC-MS préparative en phase inverse

Instrumentation:

puriFlash® 5.250
exPression® CMS
Uptisphère® Colonne StrategyTM US5C18HQ-150/300

Auteurs:

Advion Interchim Scientific, Montluçon, France Siège social

 

Introduction

La purification est une étape critique dans le développement de médicaments. De la recherche à la mise à l'échelle en passant par le processus, la purification et la confirmation sont des étapes essentielles pour mettre un médicament sur le marché. Il est essentiel de disposer d'une solution à haut débit offrant une quantité suffisante et une qualité reproductible de composés purifiés. La séparation des ingrédients pharmaceutiques actifs (API) de leurs impuretés peut être facilement réalisée avec un système de chromatographie préparative.

Cette note d'application présente la purification de cinq ingrédients actifs trouvés dans les médicaments en vente libre (OTC), y compris la caféine, la glafénine, le kétoprofène, la flavone et le fénofibrate (Figure 1), par un flux de travail de purification préparatoire avec confirmation à l'aide d'un spectromètre de masse compact.

Figure 1: Les cinq composés d'intérêt comprennent la caféine, la glafénine, le kétoprofène, la flavone et le fénofibrate. Les structures chimiques et les cas d'utilisation pharmaceutique sont mis en évidence ci-dessous.

Caféine: Produit chimique naturel aux effets stimulants, la caféine peut être trouvée purifiée sous forme de comprimés ou naturellement présente dans le café, le thé, le cacao et plus encore.

Glafénine : Anti-inflammatoire non stéroïdien (AINS), la glafénine a été retirée du marché en 1991 en raison d'un risque élevé d'anaphylaxie.

Kétoprofène : Anti-inflammatoire non stéroïdien (AINS) délivré sur ordonnance, le kétoprofène est utilisé pour traiter inflammation, gonflement, raideur et douleurs articulaires. Le médicament a été arrêté en 1995 en raison d'un risque accru de crise cardiaque, d'accident vasculaire cérébral, d'irritation et d'autres problèmes.

Flavone : Un métabolite et nématicide qui existe couramment dans les plantes.

Fénofibrate : Médicament sur ordonnance utilisé pour réduire et traiter les taux élevés de cholestérol et de triglycérides (substances semblables aux graisses) dans le sang.

Expérience

Séparation LC exploratoire

Figure 2: Pour confirmer la présence des composés pré-identifiés, une analyse exploratoire LC-UV a confirmé la présence des composés médicamenteux avant la purification.

LC préparatoire

Suite à l'identification positive des cinq composés d'intérêt et de leurs points d'élution, le mélange de médicaments était alors prêt pour une analyse LC-UV préparative sur le puriFlash® 5.250 iELSD. La purification est facilitée par le pack iELSD, permettant la détection de composés sans chromophore (Figure 3).

Résultats et validation

Résultats de séparation et de purification

L'identité des composés séparés a été confirmée à l'aide de l'Advion Interchim Scientific exPression® Spectromètre de masse compact, identifiant rapidement et avec précision les composés d'intérêt.

La pureté de ces composés peut être vérifiée en utilisant une HPLC à échelle analytique.

SOLATION®, un nouvel ICP-MS pour la détection des métaux lourds dans le cannabis et le chanvre

Introduction

Les produits à base de cannabis et de chanvre deviennent de plus en plus disponibles en usage médicinal et récréatif faire des tests de routine pour les métaux lourds toxiques beaucoup plus important.  Advion Interchim Scientific présente le SOLATION® ICP-MS pour l'analyse de métaux lourds dans échantillons de plantes de cannabis et de produits du cannabis. Bien qu'il n'y ait pas de directives fédérales pour les métaux lourds dans le cannabis, les États où la consommation et la production de cannabis sont légales ont adopté exposition limites et critères de CQ pour Arsenic, Cadmium, Mercure, et diriger basé sur USP<233>. Ici, nous rapportons les résultats de notre analyse d'échantillonsis en utilisant ces lignes directrices. 

Méthodologie

La fleur de cannabis a été achetée localement et finement broyée pour analyse. Les échantillons sont préparés à l'aide d'un système de digestion par micro-ondes (CEM Mars 6, Matthews, Caroline du Nord). Validation de la méthode en L'USP<233> est basée sur la précision, l'utilisation des récupérations de pics, la répétabilité à base d' le % RSD de six répliques digérées indépendamment et la robustesse, où ces 6 répliques sont exécutées une deuxième fois par un autre analyste, un autre instrument ou un autre jour. Les niveaux de pointe sont basés sur le "niveau d'action" défini by les limites d'exposition quotidienne maximale autorisée (PDE) de la Californie servent de guide : plomb 0.5 µg/g, arsenic et cadmium 0.2 µg/g et mercure 0.1 µg/g sont utilisés pour définir le niveau de pointe de 100 %. Les échantillons sont également dopés à 50 % et 150 % du niveau d'action. 

Données préliminaires

Pour la digestion, 0.5 g (+/- 0.002 g) d'échantillon est traité avec 9 ml conc. HNO3 et 1mL conc. HCl dans un récipient à micro-ondes et laissé à réagir pour 15 minutes avant d'être plafonné. Les récipients sont chargés sur le carrousel au micro-ondes et la méthode du cannabis "one touch", fourni par CEM, est utilisé. Les échantillons sont porté à 200°C dans 30 minutes, maintenu là pendant 10 minutes, et laisser refroidir. Le résultat est une solution claire et sans particules. Le SOLAT® L'ICP-MS a été utilisé pour analyser le échantillons pour As, Cd, Hg et Pb après digestion et dilution. le résultats montre CA la SOLATION® L'ICP-MS a pu produire des valeurs précises tel que mesuré par les récupérations de pointe qui étaient ainsi que dans les la plage de 70 à 150 %.  Les résultats des 6 résumés indépendants ont été dans les la limite définie de 20 % RSD. Répéter l'analyse des 6 digestions un autre jour montré bon accord avec les premiers résultats et ont été au sein du 25 % de spécification RSD. défini par USP<233>. Résultats globaux montrer que la SOLATION® L'ICP-MS est un outil efficace instrument pour l'analyse d'échantillons de cannabis et de chanvre.