Posted on

Qualitative Analysis of Oligonucleotides Using The Advion Interchim Scientific® HPLC-UV/MS System

Instrumentation
Mass Spec: expression® Compact Mass Spectrometer (CMS)
HPLC: AVANT®

Introduction

Oligonucleotides have gained significant attention in biopharmaceutical development due to their
ability to modulate gene or protein expression. Their clinical success is evident with the approval of several oligonucleotide-based drugs or their advancement into clinical trials.[1] These drugs include antisense oligonucleotides, small interfering RNA (siRNA) therapeutics, and mRNA-based vaccines, exemplified by the successful development of COVID-19 vaccines. Such accomplishments have spurred further interest and investment in oligonucleotide research and development.

Solid-phase synthesis is a commonly used method to produce oligonucleotide sequences. The raw material is typically purified through various techniques, such as desalting, ultrafiltration, solid-phase extraction (SPE), high-performance liquid chromatography (HPLC), or preparative liquid chromatography (prepLC), depending on the desired purity level. Ion-pairing HPLC or prepLC methods are often preferred as they offer higher purity compared to other techniques.

This application note aims to demonstrate the HPLC/UV analysis of multiple oligo samples and utilize HPLC/CMS analysis to determine their molecular weight.

Method

HPLC-UV/CMS System
With a quaternary pump and column selection valve, the process of switching between different buffers and columns for various analyses becomes remarkably straightforward, eliminating the need for manually
removing the column and changing the solvent. This automation greatly enhances efficiency and convenience in the analytical process.

Table 1: Item Instrument List


Oligo(dT) 12-18 primer
Oligo(dT) 12-18 primer (Thermos Fisher Scientific, MA) was used to check the HPLC method for oligonucleotides analysis.

The separation of these Oligo(dT) 12-18 primer was carried out using an ion-pair reverse phase HPLC method with an Interchim Uptisphere Strategy 5 μm C18HQ column 250 x 4.6 mm. A 10 μL aliquot was injected for all analyses, and the column temperature was maintained at 30°C. The mobile phase A composition was 100 mM TEAA in water, while mobile phase B is acetonitrile. And the flow rate is 1 ml/min.

The HPLC analysis proceeded as follows: After injection of the sample, mobile phase B was set at 10% for 1 minute. It was then linearly increased to 15% over 24 minutes. At 25.1 minutes, it increased to 95% and kept at this level for 2.4 minutes to clean the column. Subsequently, at 27.6 minutes, it reduced to 10% and maintained for 2.4 minutes for column equilibration.

Figure 1 illustrates that the HPLC method effectively separates the seven Oligo(dT) 12 to 18 primers.

Figure 1: HPLC/UV analysis of Oligo(dT)12-18


RNA Standard with 4 components
The RNA oligonucleotides mixture (Aglient Technologies, CA ) was prepared by diluting it 10 times with DI water before HPLC analysis. The sequences of four RNA standards are as follows: 14 mer (CACUGAAUACCAAU), 17 mer (UCACACUGAAUACCAAU), 20 mer (UCAUCACACUGAAUACCAAU), and 21 mer (GUCUCAUCACACUGAAUACCAAU).

The separation of these RNA samples was conducted using a similar HPLC method as that for oligo(dT)12-18 primers, with slight modifications.

The HPLC analysis proceeded as follows: After injection of the sample, mobile phase B was set at 9% for 1 minute. It was then linearly increased to 10% over 24 minutes. At 25.1 minutes, it increased to 95% and kept at this level for 2.4 minutes to clean the column. Subsequently, at 27.6 minutes, it reduced to 9% and maintained for 2.4 minutes for column equilibration.

Figure 2 illustrates that the HPLC method effectively separates the four RNA samples, even with a 1-mer difference between the 20-mer and 21-mer RNA samples. This baseline separation for the 20-mer and 21-mer is crucial for analyzing synthetic oligonucleotides, as most impurities during synthesis are typically N=1 mer or N+1 mer.[2]


ssDNA Samples
Three single-strand DNA samples (ssDNA) with 17 mer (GTCAGCAAGGACATCGT), 18 mer(CATTTGAGTAGCCAACGC), and 19 mer (GGACACTTTCATGCGAGTT) were also tested using the modified HPLC method from that used for RNA samples.

The concentration of each ssDNA was 30 μM, and 10 μL aliquots were loaded onto the column for analysis. The HPLC analysis was performed using the following gradient: After the sample injection, mobile phase B (MPB) was set at 9% for 1 minute, then linearly increased to 15% over 24 minutes. At 25.1 minutes, it increased to 95% and maintained at this level for 2.4 minutes to clean the column. At 27.6 minutes, the MPB was reduced to 9%, and this level was maintained for 2.4 minutes for column equilibration. The flow rate for the analysis was set to 1.5 ml/min. Despite the greater change in solvent B per minute compared to the RNA samples, Figure 3 demonstrates that the method effectively separates the three ssDNA samples with good baseline resolution.

Figure 3: HPLC/UV analysis of three ssDNA samples 1-3, three single strand DNA samples with ssDNA-1: 17 mer (GTC AGC AAG GAC ATC GT); ssDNA-2: 18 mer (CAT TTG AGT AGC CAA CGC) and ssDNA-3: 19 mer (GGA CAC TTT CAT GCG AGT T).


Purity Analysis of a ssDNA Sample
With a same method used for ssDNA samples shown in figure 3, it was also employed for the purity analysis of an ssDNA sample: 19 mer (5’-TGGCGGGCGTACCTGGACT-3’).

Figure 4 reveals that the 19-mer ssDNA 4 has a UV purity of 74.3% at 260 nm that was determined using Advion Data Express software.


MS Analysis of ssDNA sample used in F.5 purity analysis
The HPLC/MS analysis of oligonucleotides was performed using an Advion AVANT® HPLC system coupled with an Advion Expression® CMS-L. For MS analysis, the Interchim Uptisphere Strategy 2.6 μm C18-HQ column with dimensions 50 x 2.1 mm was used, with a flow rate of 0.2 ml/min. The column temperature was set to 55°C.

Compared to the use of TEAA for the mass analysis of oligonucleotides, the ion pair reagents combining TEA and HFIP offer significantly improved performance. Therefore, this application note will focus on employing TEA and HFIP ion pair reagents for the HPLC/MS analysis of oligonucleotides.

The mobile phase consisted of 15 mM TEA and 10 mM HFIP in water as mobile phase A, and methanol as mobile phase B. The total HPLC run time was 25 minutes, starting with 5% of solvent B for 1 minute.
The percentage of B was then increased to 6% over 14 minutes, followed by an increase to 95% at 15.1 minutes that was kept for 2.9 minutes to elute the compounds of interest. Subsequently, the % B was reduced to 5% and kept at this level for 6.9 minutes to equilibrate the column before the next analysis.

The MS analysis was conducted in negative ESI mode with the MS scan range set from 500 to 2000 Da. Figure 5b shows the MS spectra of ssDNA-4, displaying a charged envelope with peaks at m/z 1463.9 (4-), 1170.8 (5-), (975.8 (6-), 936.0 (7-), 731.8 (8-), and 650.2 (9-). Through charge deconvolution in Data Express, the uncharged mass for the ssDNA sample was determined to be 5861.8 Da, which closely matches the theoretical value of 5860.8 Da.

Figure 5: HPLC/MS analysis of ssDNA-4 (5-TGG CGG GCG TAC CTG GAC T-3), MW 5860.8 Da


Figure 6: HPLC/MS analysis of ssDNA-5 (5-GGGTGG-CAT-TAT-GCT-GAG-T-3), mw 5914.9


MS Analysis of a Further Example Sample
The MS spectra of ssDNA-5 (5’-GGG-TGG-CAT-TATGCT-GAG-T-3’) are depicted in Figure 6, showing a charged envelope with peaks at m/z 1477.8(4-), 1182.1(5-), 984.7(6-), 843.8(7-), and 738.2(8-). By charge deconvolution the uncharged mass for the ssDNA-5 was determined to be 5913.9, which is in close agreement with the theoretical value of 5914.9.

Conclusion

Using a 5 μm particle size C18HQ column coupled with TEAA (Triethylammonium acetate) ion-pairing reagent has been demonstrated to be suitable solution for oligonucleotide HPLC analysis.

For MS analysis of Oligonucleotides, the same C18HQ column can be employed with HFIP (hexafluoroisopropanol) and TEA (triethylamine) as the ion-pairing reagent in conjunction with an AVANT® HPLC-UV/CMS system. This method has been proven to yield additional accurate mass measurements of Oligonucleotides.

Overall, utilizing the Interchim C18HQ column and the appropriate ion-pairing reagent in combination with the AVANT® HPLC-UV and -CMS system can provide a reliable solution for the purity analysis and characterization of oligonucleotides.

References
[1]Roberts, T.C., Langer, R. & Wood, M.J.A. Advances in oligonucleotide drug delivery. Nat Rev Drug Discov 2020, 19, 673–694
[2]Martina C. et.al. Oligonucleotides: Current Trends and Innovative Applications in the Synthesis, Characterization, and Purification, Biotechnology J. 2020, 1900226

Posted on

The Extraction, Identification, Purification and Quantitation of Cyanidin-3-Glucoside in Black Rice

Instrumentation
Flash: puriFlash® 5.250, XS-Vap®
Mass Spec: expression® Compact Mass Spectrometer (CMS)
HPLC: AVANT™

Introduction
Rice is one of the more essential foods in the world, especially in Asian countries. Amongst the pigmented rice varieties, black rice has received increasing attention because of its high nutritive value and beneficial health properties. Black rice is an anthocyanin enriched pigmented rice that contains Cyanidin-3-glucoside (Cyn-3-Glu), Cyanidin-3-rutinoside (Cyn-3-Rut), Peonidin-3-glucoside (Pn-3-Glu) and other anthocyanins. Cyanidin-3-glucoside is the dominant anthocyanin in black rice.

This application note shows how Cyanidin-3-glucoside is extracted from black rice and purified with a prepLC/Flash system. The amount and purity of Cyn-3-Glu is measured utilizing a certified reference standard.

Method
Cyanidin-3-glucoside Extraction
Black rice was purchased from a local grocery store, ground into fine powder with a spice grinder, and extracted with the following method:
1. 30 grams of the ground black rice was mixed with 200 mL of methanol acidified with 1.0 N HCl (85:15, v/v) and sonicated for 15 min.
2. The mixture was centrifuged at 7500 rpm at 4°C for 5 min. The supernatant was decanted into a clean flask. The pellet was extracted again with 200 ml of methanol acidified with 1.0 N HCl (85:15, v/v), and sonicated for 15 min.
3. Supernatant from the two extractions was combined and reduced to 25 ml using a rotatory evaporator.
4. A small part of the concentrated extract was diluted 10x with water for HPLC/UV/MS analysis, the rest was loaded directly on a PrepLC/Flash system for purification.

Analytical HPLC/UV/MS Setup
Table 1: Analytical HPLC/UV/MS method for the black rice extract.

Analytical HPLC/MS Analysis of Black Rice Extract
The concentrated extract of black rice was diluted 10x with distilled water for HPLC/CMS analysis.

With mass range from 200 to 800 Da, HPLC/MS chromatogram is shown in Figure 1a. The average MS spectrum from the peak at 12.10 min is shown in Figure 1b with a single ion at m/z 449.2 detected in the positive ESI mode. The MS spectrum with in-source CID is shown in Figure 1c showing a confirmative fragment ion at m/z 287.0

Figure 1: A). The HPLC/MS Chromatogram of black rice extract, B). The average mass spectra of peak at 12.10 min, C). The average mass spectra of peak at 12.10 min with in-source CID at 30V.

MS Spectra Database Search
Through the MS spectra database search in Advion Data Express, the compound eluted at 12.1 min is confirmed as Cyanidin-3-glucoside (Cyn-3-Glu).

Figure 2: Library search result of the average MS spectra in Figure 1c extract.

Peak Express Software Helps to Detect other Anthocyanin
The Peak Express™ software implemented in Data Express can dynamically determine the rate of change of intensity and standard deviation of all ions being detected and only display the ions that exceed a preset threshold setting.

Peak Express™ helps to detect another peak at 14.41 min in the ΔIC chromatogram (Figure 3b) that is barely indicated in its TIC chromatogram (Figure 3a). ΔS Delta Spectrum with the in-source CID shows two ions detected at m/z 463.3 and 301.1.

MS spectrum database search determines that it is Peonidin-3-O-glucoside (Search result is shown in Figure 4).

Figure 3: A). The HPLC/MS chromatogram of black rice extract, B). The ΔIC chromatogram of black rice extract C). The ΔS Delta Spectrum of peak at 14.41 min with in-source CID at 30V

Figure 4: The library search result of the ΔS Delta Spectrum in Figure 3c

HPLC/UV Analysis of Black Rice Extract
The black rice extract was also analyzed by HPLC/UV. Two characteristic UV absorption peaks of Cyn-3-Glu at 12.01 min are found at 278 nm and 518 nm (Figure 5b).

520 nm is used to trigger the fraction collection in the purification with a PrepLC/Flash system.

Figure 5: A). The HPLC/UV chromatogram of black rice extract, B). The UV absorbance profile from peak at 12.07 min

PrepLC Method for cyn-3-glu Purification
Table 2: PrepLC method for Cyn-3-Glu purification

Purification
Black rice extract purifications are performed on an Advion Interchim Scientific puriFlash® 5.250 PrepLC/Flash system.

The detail information of solvents and separation method is listed in the method table. Typical PrepLC/UV chromatogram of the black rice extract (3 ml sample) is shown in Figure 6.

Each fraction collected is additionally analyzed by HPLC-UV/MS to confirm identification and provide additional purity analysis.

Figure 6: The prepLC chromatogram (520 nm) of black rice extract on puriFlash® 5.250 PrepLC/Flash system

HPLC/UV Analysis of Fraction 2, 5 and 8
All fractions are analyzed by HPLC/UV/MS. HPLC/MS analysis of fraction 1 shows an impurity with the m/z 611, and low UV response of Cyn-3-Glu. And fractions 2-8 have a purity of more than 97.6 %. The HPLC/UV chromatograms of fraction 2, 5 and 8 are used as examples shown in Figure 7 with purities of 97.6% for 2, 100% for fraction 5 and 8.

Except for the first fraction, all fractions were combined for dryness. The drying of fractions was performed on an Advion Interchim Scientific puriFlash® XS-Vap system at room temperature. The weight of Cyn-3-Glu purified from 30g black rice is 25.8 mg.

Figure 7: The HPLC/UV chromatogram of fractions a) Fraction 2, b) Fraction 5, c) Fraction 8.

Quantitation of C3G by HPLC/UV
To confirm the final purity of the dried sample, a certified reference standard of Cyn-3-Glu was used for the quantitative analysis of dry Cyn-3-Glu to check its purity. HPLC calibration curve of Cyn-3-Glu reference is shown in Figure 8.

The measured amount of Cyn-3-Glu is 25.5 mg with a purity of 99.0%.

Figure 8: HPLC/UV calibration curve of Cyn-3-Glu reference standard

Conclusion
With the developed HPLC/UV/MS and PrepLC methods, Cyn-3-Glu in black rice extract can be separated, purified, and quantified.

25.5 mg of Cyn-3-Glu was purified from 30g black rice with a purity of 99.0%.
Combination of Interchim PrepLC/Flash and Advion HPLC-UV/CMS is a simple and cost-effective solution for extracting and purifying Cyn-3-Glu from rice sample or samples containing Cyn-3-Glu.

Following this general workflow:

HPLC/CMS provides a simple way for the identification and purity analysis of target compounds in natural product purification.

Posted on

Purification of Bioactive Peptides from Complex Mixtures using the puriFlash® 5.250 PrepLC and expression® CMS Detector

Instrumentation
Mass Spec: expression® CMS
Flash: puriFlash® 5.250 prepLC
HPLC: AVANT®

Author
Changtong Hao
Advion Interchim Scientific

Introduction
In recent years, biopharmaceutical companies have increasingly embraced peptide/protein-based drugs due to their enhanced specificity and selectivity compared to traditional small molecule drugs. However, the purification of peptides/proteins during the drug discovery process is crucial to ensure the safety and efficacy of the final product. Attaining the highest possible purity levels for the bioactive target compounds is essential in minimizing the risk of toxicity and complying with regulatory standards.[1,2]

Whey protein isolate, a by-product of cheese production, contains various glycomacropeptides and two significant bioactive peptides, casein macropeptide A (CMPa) with a molecular weight (MW) of 6757 Da and casein macropeptide B (CMPb) with a MW of 6787 Da. Extracting and purifying individual components, such as casein
macropeptide, is essential for investigating their bioactivity.[3]

In this application note we use whey protein isolate and two casein macropeptides as an example to demonstrate the isolation and purification of bioactive components with a system comprised of a puriFlash® 5.250 prepLC coupled online to an expression® CMS detector. This combination offers higher selectivity and sensitivity compared to traditional detectors such as UV or ELSD, which may not effectively respond to bioactive target peptides and proteins.


Advion Interchim Scientific
puriFlash® 5.250


Advion Interchim Scientific
expression® CMS

Method
Preparation of Whey Protein Isolate
• The casein macropeptide isolation procedure used in this application is based on Tadao Saito’s work[4] with some modifications.
• A 50 g sample of whey protein isolate purchased from local grocery store was combined with 500 mL of a solvent mixture of 70% water and 30% methanol (v/v). The mixture was sonicated at 70°C for 90 minutes and then filtered under reduced pressure.
• The resulting filtrate was concentrated to a volume of 300 mL by removing methanol using a rotary evaporator under reduced pressure at 40 °C. It was then stored at 4°C for one hour. Subsequently, an equal volume of cold ethanol was added to the solution, and the mixture was vortexed for 5 minutes before being stored at 4°C for an additional 4 hours.
• The mixture was filtered under reduced pressure using a 0.5 μm filter. The final filtrate was then concentrated to a volume of 50 mL using a rotary evaporator under reduced pressure.
• A 100 μL aliquot of the concentrated extract was mixed with 900 μL of deionized (DI)
water for analytical HPLC/MS analysis.
• The remaining filtrate was used for peptide purification using the puriFlash® 5.250 PrepLC system coupled with an expression® CMS detector.

Table 1: Analytical HPLC/MS Method Setup

Analytical HPLC/MS Method Setup
The liquid extract from whey protein isolate was first analyzed using an AVANT® HPLC/CMS system and a chromatography separation method developed for the 4.6 mm column used (Table 1).

Figure 1a shows the HPLC/MS chromatogram of the liquid extract. The averaged MS spectra from the peak at 6.44 min indicates that the compound is a multiply charged peptide with at least five masses at m/z 755.2, 849.4, 970.6, 1132.1, and 1358.6 (Figure 1b) forming a charge profile.

Through software charge deconvolution, the uncharged mass of the peptide was determined to be 6787.4 Da, indicating casein macropeptide B (CMPb, theoretical mass of 6787 Da) (Figure 1c).


Advion Interchim Scientific
AVANT® (U)HPLC


Figure 1: (a) HPLC/MS chromatogram of liquid extract from whey protein isolate, (b) The averaged MS spectra from peak at RT 6.44 min, (c) The deconvoluted, uncharged mass of the peptide eluting peak at RT 6.44 min.


Figure 2: (a) HPLC/MS chromatogram of liquid extract from whey protein isolate, (b) The averaged MS spectra from peak at RT 11.02 min, (c) The deconvoluted, uncharged mass of the peptide eluting at RT 11.02 min.

The averaged MS spectra obtained from the peak eluting at 11.02 min suggest that the compound is also a multiply charged peptide with masses at m/z 751.5, 845.4, 966.1, 1126.8, and 1352.1 (Figure 2b) forming its charge profile.

Similarly, charge deconvolution determines the uncharged mass of this peptide to be 6755.3 Da indicating the A variant of casein macropeptide, CMPa with a theoretical mass of 6755 Da (Figure 2c).


Advion Interchim Scientific
puriFlash® 5.250, MS Splitter and expression® CMS

PrepLC/MS Chromatography
In a next step, the analytical separation method was transposed to the larger prep scale from 4.6 mm column ID to 30 mm ID column ID and further optimized for the purification of the two CMPs (casein glyco-macropeptides) on the puriFlash® 5.250 PrepLC/Flash system coupled online to the expression® CMS detector.

The PrepLC-UV/MS chromatogram of the whey protein isolate is shown in Figure 3 and parameters shown in Table 2.

Fraction collection was triggered based on the MS signal, chosen for its higher selectivity and sensitivity. XIC of 970-971 Da was used to detect CMPb, and XIC of 965-966 Da for CMPa.

The organic solvent in the combination of fractions 11-17 and fraction 18-22 was removed using a rotary evaporator under negative pressure, and the remaining aqueous
solution was dried using a LABCONCO Freezone 2.5L (-50 C) lyophilizer, resulting in a dry collection of 10 mg each, which was then dissolved in 10 ml of deionized water for subsequent HPLC/UV/MS analysis. The results of the purity analysis are shown in figures 4 and 6.

Table 2: PrepLC/MS Method Setup


Figure 3: The PrepLC-UV/MS chromatogram of two whey protein isolate

Results

Purity Analysis of CMPb
Purity analysis of CMPb in the pooled fractions 11 to 17 is shown in Figure 4. MS analysis shows that four major ions were detected with m/z at 970.8, 1132.3, 1358.6 and 1968.2 (Figure 4b).

With the averaged mass spectra from Figure 4b, the uncharged mass of the peak at 5.94 min was determined to be 6788.4 (CMPb, Figure 4c). However, MS analysis can also detect four minor components at 6758.3, 6773.5, 6804.8 and 6868.4 Da.

The obtained UV purity of CMPb is 86.7% (Figure 4d), but, based on the additional MS data, the compound purity is actually less then that (estimated 80%).

CMPa in the pooled fractions 18 to 22 was measured to be 94.7% (figure 5a) based on UV analysis of the analytical run.

The deconvoluted uncharged mass analysis shows the expected dominant mass 6756.2 of CMPa (figure 5b), and one minor component at 6774.6, an oxidized form of CMPa.

Again, this example shows the value of MS detection of bioactive compounds such as peptide and proteins, and the better specificity of MS detection compared to UV.


Figure 4: (a) The HPLC-MS chromatogram of pooled fractions of 11-17, (b) Averaged MS spectra of peak eluting at RT 5.94 min, (c) the uncharged mass from (b), (d) The HPLCUV chromatogram of pooled fractions of 11-17.


Figure 5: (a) The HPLC-UV chromatogram of pooled fractions of 18-22. (b) deconvoluted uncharged mass of CMPa.

The final overall purity is estimated to be ca. 90%, an excellent value for a bioactive molecule in drug discovery.

Further improvement in purity can be achieved with selective fractions – at the cost of yield. For example, the HPLC-UV/MS analysis of fraction 20 of CMPa (Figure 6a) shows a UV purity of 99.0% (Figure 6d) and no oxidized by-product in the MS analysis.


Figure 6: (a) The HPLC-MS chromatogram of fraction 20, (b) Averaged MS spectra of peak at RT 5.71 min, (c) deconvoluted uncharged mass of CMPa (d) The HPLCUV chromatogram of fractions 20.

Conclusion
The puriFlash® 5.250 PrepLC/Flash system, coupled on-line with an expression® CMS detector, achieves outstanding performance, facilitating the selective purification of bioactive macropeptides from a complex matrix with high level of confidence. Compared to UV or ELSD detectors, the mass spectrometer delivers superior selectivity and sensitivity.

An illustrative application of this approach shows the isolation of casein glycol-macro-peptides, resulting in a purity range of 80% (CMPb) to 90% (CMPa) through combined fractions with high yield. Even higher purity of up to 99.0% can be achieved with selective fractions.

 

REFERENCES

[1]Gräslund, S., et al. (2008). Protein production and purification. Nature methods, 5(2), 135-146.
[2]Biopharmaceutical Processing: Development, Design, and Implementation of Manufacturing Processes.
[3]Lin T., et al. (2021) Bioactives in bovine milk: chemistry, technology, and applications Nutrition Reviews v79(S2):48–69
[4]Saito T., er al. (1991) A new isolation method of caseinoglycopeptide from sweet cheese whey. J. Dairy Sci. 74, 2831-2837

Posted on

Analysis of Iohexol using the Advion Interchim Scientific AVANT® HPLC and expression® CMS System

Introduction

Iohexol is a widely used non-ionic imaging agent that improves contrast for x–ray analysis. Its low osmolality allows for a rapid clearance via the kidney, preventing reabsorption and further metabolization[1]. This makes iohexol a compound with a better safety profile compared to other imaging agents[2]. 

In many clinical imaging applications, imaging agents/contrast agents are administered to patients to improve the contrast and spatial resolution of the scan. Due to toxicity and side effects of imaging agent, preparations of their known concentrations and their purity analysis are very important for their safe use and accurate diagnostic. 

In this application note, a simple and accurate HPLC-CMS method for iohexol analysis is introduced.

Method

Method Setup

All solvents used in the application were HPLC grade.

Two Iohexol standards were obtained from Sigma Aldrich.

One was a certified reference material with purity of 99.99%, the second one had a stated purity of ≥ 95%.

All experiments were performed on an Advion Interchim Scientific® expression® Compact Mass Spectrometer coupled with an AVANT® UHPLC system with parameters as shown in Table 1.

Table 1: HPLC/MS Method

HPLC/UV/MS Analysis of Iohexol

At room temperature, iohexol will isomerize with two peaks detected in its HPLC/UV/MS analysis. 

These two peaks (Figure 1A) come from hindered rotation of the anilide N-acetyl group due to the bulky iodine atoms attached to the central benzene ring of the iohexol. Those two compounds are essentially “rotational isomers” that interchange slowly at room temperature in aqueous solution.

Both peaks are confirmed with MS analysis to show the same m/z at 821.9 (Figure 1B and 1C) and no difference was visible in their in-source CID mass spectra (Figure 2A and 2B). 

Since both rotamers contribute to the compounds toxicity and imaging enhancing capabilities in x-ray analysis, the sum of both peaks will be used for any further iohexol analysis in this application note. 


Figure 1: (A) HPLC chromatogram (254 nm) of iohexol, (B) The extraction ion chromatogram of protonated iohexol at m/z 821.8, (C) The averaged MS spectra from peak at RT 4.06 min.


Figure 2: (A) The averaged in-source CID mass spectra from peak at RT 3.61 min, (B) The averaged in-source CID mass spectra from peak at RT 4.06 min.

Purity Determination by HPLC/UV Analysis

By comparing the HPLC response from iohexol sample to the response of the iohexol certified standard at a similar concentration, the peak area ratio of sample to certified standard can provide a quick concentration and purity analysis. 

The equation to calculate the concentration ratio of iohexol is shown below:

The HPLC chromatograms of iohexol sample and certified reference are shown in Figure 3A and 3B.

The averaged value of summed two peak areas is 714 for iohexol sample (Figure 3A), and 740 for iohexol reference standard (Figure 3B). With the calculation of concentration ration, the calculated concentration of iohexol in the sample is 0.0964 mg/ml which equals a purity of 96.4% – in line with the stated product purity of ≥ 95%.


Figure 3: (A) HPLC chromatogram (254 nm) of iohexol sample (0.1 mg/ml) (B) HPLC chromatogram (254 nm) of iohexol reference standard (0.1 mg/ml).

Quantitation by HPLC/UV Analysis

To check the purity of an iohexol sample more accurately, a calibration curve of iohexol certified standard material was created with five different dilution levels from 25 to 500 μg/mL and with triplicate injections for each concentration. The R-squared value of the resulting linear calibration function is 0.9999 (Figure 4) showing excellent linearity. 

By way of the iohexol calibration curve approach, the purity of the iohexol sample was determined to be 97.5%. 

This value is also right above the stated purity of min 95% of the sample and differs by only 1.1% from the measured value by direct UV response ratio analysis of the iohexol sample to iohexol reference standard.

Both purity determination by way of a calibration function or by direct UV response ratio analysis can be used for organic chemicals with UV absorbances if certified reference standard material is available.

The calibration function method will provide a more accurate measurement.


Figure 4: Calibration curve of iohexol by HPLC chromatogram (254 nm)

Conclusion

The Advion Interchim Scientific AVANT® (U)HPLC system can provide accurate chromatographic methods for the purity analysis of imaging agents as shown for iohexol. Coupling UHPLC with the Advion Interchim Scientific expression® Compact Mass Spectrometer not only provides confirmations of target compounds via their mass and in-source fragmentation pattern, but also allows for rapid determination of impurities. 

REFERENCES
[1] T. Almen, Development of nonionic contrast media., Invest. Radiol. (1985) Investigative Radiology. 1985, 20(1), S2-S9.
[2] R.D. Moore, E.P. Steinberg, N.R. Powe, R.I. White, J.A. Brinker, E.K. Fishman, S.J. Zinreich, C.R. Smith, Frequency and determinants of adverse reactions induced by high-osmolality contrast media., Radiology. 1989, 170, 727-32.