Posted on

Rapid and Automated Peptide Mapping of Protein Therapeutics

Instrumentation
Mass Spec: Thermo Scientific Orbitrap® Instruments
Sampling: TriVersa NanoMate LESA®

Authors
Josh Coon, PhD
University of Wisconsin-Madison and CeleramAb™

Daniel Eikel, PhD
Advion Interchim Scientific®

Introduction

In contrast to small molecule drugs, biologics (or protein therapeutics) such as antibodies can be very powerful drugs because they target biological pathways with much higher specificity thereby enabling treatment of complex diseases such as cancer, autoimmune disorders or metabolic conditions and reducing unwanted side effects at the same time. Precise characterization of these biologics – including their structure, post-translational modifications, stability, and activity—is essential to ensure their safety, efficacy, and consistency across production batches. Even small changes in protein folding caused, for example, by a chemical modification on one amino acid can diminish a protein therapeutics’ function or worse, trigger unwanted immune responses. Rigorous analytical methods therefore guide optimal design, manufacturability, and quality control. Accurate characterization also supports regulatory approval and helps identify biomarkers or mechanisms that improve therapeutic performance and patient outcomes.

Here we describe a protein/antibody characterization approach based on standardized enzymatic digestion in 96 well plates, the rapid injection of the generated peptides into high resolution mass spectrometers and subsequent automated data analysis for full protein sequence characterization of up to 1000 mAbs a day (Figure 1).

Advion Interchim Scientific® Systems

TriVersa NanoMate LESA® with ESI Chip® Technology

Figure 1: Combining the technology from CeleramAb™ and Advion Interchim Scientific® to create a protein therapeutic analysis approach based on enzymatic protein digestion, direct infusion MS, MS/MS and automated data processing to achieve a 1000 mAbs throughput a day.

Concepts & Experiments

Protein therapeutics can degrade based on various factors such as time, pH changes, light or heat exposure causing changes to amino acids along the peptide sequence of the biologic drug, changes like deamidation, oxidation or pyrolization, which may cause folding and function changes. Figure 2 depicts typical changes observed on an antibody. Other changes in the glycosylation, phosphorylation or Cys-Cys oxidation state will also impact the folding and function of a biologic. All these modifications must therefore be investigated, characterized and ultimately routinely maintained and controlled to generate a valuable new drug.

Figure 2: Protein therapeutics can degrade based on various factors such as time, pH changes, light or heat exposure causing changes to amino acids along the peptide sequence of the biologic drug, changes like de-amidation, oxidation or pyrolization.

A typical way to analyze protein sequences is the enzymatic digestion of the protein to its peptide building blocks and their respective analysis in LC-MS/MS. The chromatography separates the peptides in time and mass spectrometry allows the mass spectral analysis of the peptides generating fragmentation ions and therefore sequence information. Historically, such LC-MS/MS runs took a long time, with 30-120 minutes being typical run times, and required extensive off-line data analysis to show complete sequence coverage and characterization of the protein. Both these factors severely limited the number of samples that could be processed in a day and indirectly limited the number of attempted experiments with therapeutic proteins.

Instead of time-consuming LC-MS/MS, we present an approach utilizing direct infusion (DI) mass spectrometry in an automated fashion. This approach has become viable since modern mass spectrometers have a much higher cycle time to run MSn experiments and allow for high mass accuracy and high mass resolution for unequivocal assignments of peptide sequences and modifications directly from the MS data. Development of an automated ion source based on ESI chip® technology provides consistent and highly efficient nano ESI ionization using a sample path of one sample, one tip and a new nESI emitter for every consecutive sample – eliminating cross contamination entirely. As shown in Figure 3, this approach utilizes standardized reagents in a 96 well format for the enzymatic digestion of antibodies following reproducible protocols, and the NanoMate Triversa automated robotic sample infusion system to ionize the generated peptides and analyze them in the mass spectrometer to generate information rich mass spectra of every sample in just one minute. Data processing is also automated with customized software to address both described bottlenecks above, resulting in a throughput of up to 1000 samples a day.

Figure 3: Schematic of the peptide mapping workflow based on standardized antibody digestion of the protein therapeutic in 96 well plates, rapid and automated direct infusion high resolution mass spectrometry to generate information rich MS data (data is automatically processed for a throughput of 1000 mAbs a day).

Experimental Setup & Methods

Figure 4 shows a typical set of experiments with this Direct Injection – MS/MS (DI-MS/MS) approach. Here, two different samples (Antibody X and a NIST standard antibody) were tested for stability under heat and pH changes in triplicate.

After standard digestion, the samples were injected into the MS system as described and the raw MS data is shown. In a little over one hour, 42 samples covering the stability experiment and controls were analyzed. On the time line you can see bursts of MS data intensity for each of the 1 min infusion experiments followed by periods of no data (reflecting the time the robot takes to bring the next sample to the MS system). This one hour is roughly the same time frame typically consumed for only one sample in a traditional LC-MS approach.

Example analysis of the peptide DTLMISR illustrates the work flow. Figure 5 shows the MS data of an oxidized methionine amino acid in the peptide sequence DTLM(ox)ISR of a therapeutic antibody. A typical LC-MS analysis approach would require 30-120 min to separate the protein digest followed by manual data inspection. However, the DI-MS/MS based approach only requires a 1 min run time with both related peptides (native and oxidized state) separated in the gas phase by their mass-to-charge ratio and detected by an automated mass shift algorithm. Calculations of the oxidation state is determined by ion intensity and calculated to 19.6% oxidation, which is in perfect agreement with the LC-MS result – however, the information is obtained in a fraction of time.

Figure 4: Example of a sample sequence with 14 samples run in triplicate within a little over one hour. Both proteins (antibody X and a NIST standard mAb) were exposed and tested against various conditions (pH and temperature). Each run represents 1 min infusion MS data collected for further processing and peptide identification and modification analysis.

Figure 5: Example data analysis of an oxidized methionine amino acid in the peptide sequence DTLMISR of a therapeutic antibody. Typical LC-MS/MS analysis approach would require 30-120 min to separate the protein digest followed by manual data inspection. However, the Direct Infusion-MS/MS based approach only requires a 1 min run time with both related peptide sequences separated in the gas phase and detected by an automated mass shift algorithm. Calculations of the oxidation state is determined by ion intensity and calculated to 19.6% oxidation, which is in perfect agreement with the LC-MS/MS result – however the information is obtained in a fraction of time.

Conclusion

The Advion Interchim Scientific® TriVersa NanoMate® automated ion source is the perfect tool to support high throughput workflows in the characterization of therapeutic proteins based on peptide mapping strategies. In combination with the CeleramAb™ standardized reagent kit, mass spectrometry run methods and automated analysis software tools we can achieve a throughput increase by a factor of 100 compared to standard LC-MS approaches resulting in up to 1000 mAbs analyzed in a day.

Posted on

Flash Purification of Carbohydrates with puriFlash® 5.030 and Integrated ELSD

Instrumentation
Flash chromatography system: puriFlash® 5.030 with pack iELSD
Column: puriFlash® 50µm NH2 F0025

Author
Applications Team
Advion Interchim Scientific

Introduction
Carbohydrates are non-chromophoric compounds that often lead to flat signals when using UV detection only. In this application note, we show carbohydrate purification with ELSD and how such detection can help in purification.

Why use ELSD from Advion Interchim Scientific?

    • Detect chromophoric and non chromophoric compounds as carbohydrates
    • Low maintenance with Isopropanol make-up solvent for ELSD
    • IPA push the sample to the ELSD
    • System cleaning meanwhile processing to purification => almost maintenance freeAutomatic refill
    • Eliminates risk of signal saturation or non-detection
    • Allow to detect and collect low concentration compounds
    • Easy set up (no parameters to predict, easy to use)
    • Automatic gain to clearly see all compounds at the same time (Figure 1)
    • Low sample consumption 40µL/min
    • ELSD is a destructive detection mode, thank to automated spliter quantity send to detector is control
    • Low gas consumption (1 – 1.5L/min at 1-1.5bar)
    • Low temperature technology


    Figure 1: Automatic gain allows users to clearly see all compounds at the same time

    Method
    Experimental Set Up
    Flash chromatography system: puriFlash® 5.030 with pack iELSD
    Column puriFlash®: 50µm NH2 F0025
    Sample: D(-)Fructose 100mg
    Alpha (D)-Lactose 100mg
    Detector: ELSD 35°C
    UV: 254nm

    Results & Discussion
    ELSD Signal

    Figure 2: ELSD showing a good signal intensity and smoothing.

    UV Signal 254nm

    UV Signal SCAN 200-800nm

    Figure 3 & 4: Compounds are not visible with UV. Scan start to show low intensity for the first compounds, but not enough to get good collection.

    Conclusion
    Carbohydrates are non-chromophore compounds and can’t be detected by UV, it is necessary to use ELSD detector that provide good detection.

    The ELSD detector that AIS propose is capable of provide several benefits for user:

  • no need to define gain depending on the loading
  • Thanks to low temperature technology, it is possible to look more compounds (especially temperature sensitive or volatile)
  • In this application we used water and 35°C was enough to remove water response and get flat signal.
Posted on

Advanced Arsenic Speciation In Water Using HPLC-ICP-MS

Instrumentation:
ICP: SOLATION® ICP-MS
LC: AVANT® (U)HPLC

Author:
Dr. Fadi Abou-Shakra
Advion Interchim Scientific®

Introduction
Arsenic (As) is a toxic element found in various environmental matrices, including water, soil, and food. The toxicity of arsenic is highly dependent on its chemical form. Inorganic arsenic is a particularly toxic form of arsenic that is often found in water sources, posing significant health risks such as skin lesions and cancer. Therefore, accurate detection and quantification of inorganic arsenic species are crucial for ensuring water safety and compliance with regulatory standards. HPLC-ICP-MS is a very powerful analytical tool for performing such analyses.

HPLC-ICP-MS combines the separation capabilities of HPLC with the sensitive detection of ICP-MS. HPLC separates arsenic species based on their chemical properties, while ICP-MS detects and quantifies these species with high sensitivity and precision.

The Advion Interchim Scientific speciation solution offers several key features that assist the end user in developing robust HPLC-ICP-MS methods including:
1. A fully integrated software that controls both the SOLATION® ICP-MS and the AVANT® HPLC system. In addition, the ICP-MS Express software allows for the control of a UV-DAD detector for real time review of ICP-MS and UV data permitting the end user to troubleshoot any chromatographic issues during method development.
2. Advanced quantitation routines such as a built in speciated isotope dilution routines for ultimate accuracy and semiquantitative calculations to report on the concentration of unknown species.
3. Simplified data review: that allows on the fly changing the peak integration parameters, speeding up the process of method development.
4. Flexible reporting allowing for the easy generation of reports and simplifying data export to integrate with LIMS or other lab data systems.
5. Automated column switching for multi-element speciation analysis to allow for sequential unattended analysis of different sample batches.

Methodology
Inorganic arsenic species in the form of solid As(III) oxide and As(V) oxide as well as ammonium dihydrogen phosphate were obtained from Oakwood Chemicals, USA. The separation of the 2 species of As was conducted on an Advion Interchim Scientific® C18 column, Uptisphere strategy 100A, particle size 5 µm, length 250 mm and ID 3 mm. The mobile phase consisted of 5 mM ammonium dihydrogen phosphate, 0.05 % acetonitrile adjusted to pH 2.6.

Separation and Results
Figure 1 shows the separation of the two inorganic arsenic peaks together with the response from an internal standard spike injected to correct for potential drift after time. The impact of using the spike to normalize the signal on the long-term stability of the analysis is highlighted in Figure 2.


Figure 1: The separation of As(III) and As(V) using a C18 column.

The long-term stability of the separation is assessed using two variables, the peak area and the retention time of the eluted peaks.

Figure 2 the stability of the peak area of 1 ppb As(V) over 4 hours with and without normalization. Although the long-term stability for 50 µL injections of 1 ppb As(V) over 4 hours was < 10%, normalizing the signal by ratioing it to the peak area of the injected spike improved that precision to less than 3%.


Figure 2: Stability of the peak area for 1 ppb As(V) over 4 hours of analysis. An upward drift in response could be seen on the graph (orange squares) that was successfully corrected for using an internal standard (blue diamond).

On the other hand, looking at the stability of the retention time as shown in Figure 3, we can clearly see that the peaks retention time did not drift over the 4 hours period of analyses.


Figure 3: Stability of the retention time for As(V) over 4 hours with and without internal standard, no drift could be detected.

In order to establish the detection limit of the method, Figure 4 shows the peak list generated by the software listing the peaks and the relevant S/N ratio. With a signal to noise ratio 112 for 1 ppb As(V) this translates to < 30 ppt detection limits based 3 x the S/N ratio.


Figure 4: Peak list generated from 1 ppb As(V) and 0.25 ppb As(III) showing great S/N ratios and highlighting the detection power of the system.

Conclusion
HPLC-ICP-MS is a vital technique for arsenic speciation, providing accurate and reliable data essential for environmental and food safety assessments. In this application brief we demonstrated the ability of the speciation solution using the SOLATION® ICP-MS. A repeatable and dependable separation was achieved and detection limits in the ppt range could be easily attained. The fully automated capability of the system allows the user to run the samples unattended and process the data/generate reports with minimal intervention.

Posted on

Efficient Reaction Monitoring with Advion Interchim Scientific ASAP-CMS for Compounds Requiring Polarity Switching in Medicinal Chemistry

Instrumentation:
Mass Spec: expression® CMS
Sampling: Atmospheric Solids Analysis Probe – ASAP®
Software: MassExpress

Authors
Changtong Hao, Ph.D.
Advion Interchim Scientific

Introduction
In medicinal chemistry, rapid and reliable analytical techniques are crucial for the discovery of new drug products. Mass spectrometry (MS) is a key technique for reaction monitoring that provides essential molecular information about a product at each stage of discovery.

Medicinal chemists often encounter specific challenges when monitoring reactions, such as:
– Ionization Mode Ambiguity: The lack of prior information on the optimal ionization mode (positive or negative) can lead to incomplete data.
– Developing separate methods for each ionization mode may delay progress in a fast-paced field that demands quick insights.
– Limited access to specialized instruments or expertise can also hinder analysis.

Advion Interchim Scientific System
expression® CMS with Atmospheric Solids
Analysis Probe (ASAP®)

Method
The Advion Interchim Scientific® Atmospheric Solids Analysis Probe (ASAP®), integrated with the expression® Compact Mass Spectrometer (CMS) and MassExpress software, uses rapid polarity switching and versatile sample introduction techniques to offering an innovative solution to these challenges:

Rapid Polarity Switching: Seamlessly transitions between positive and negative ion modes, ensuring comprehensive data capture without method changes.
Versatile Sample Introduction: Atmospheric Solids Analysis Probe (ASAP®) enables direct analysis of solid and liquid samples, reducing preparation time.
Enhanced Data Integrity: Accurate identification of compounds with distinct ionization preferences minimizes the risk of missing critical information.

Here is the case where chemist cannot get a successful detection with their traditional LC-MS analysis of the reaction Monitoring with Dual Polarity Detection.

Scenario: Differentiating between a reactant and its product, each exhibiting exclusive ionization behavior.
Reactant (C5H2Br2O2S): Detectable only in negative ion mode, showing peaks at m/z 282.8, 284.8, and 286.8 displaying a characteristic 1:2:1 bromine isotopic pattern.
Product (C6H4Br2O2S): Undetectable in negative ion mode but clearly observed in positive ion mode at m/z 298.8, 300.8, and 302.8, also displaying the same classic 1:2:1 bromine isotopic distribution.


Figure 1: Reaction Path


Figure 2: A top). MS spectrum of starting material in negative mode. B bottom). MS spectrum of product in positive mode.

Using the Advion Interchim Scientific’s ASAP-MS’s rapid polarity switching feature, both compounds were accurately identified within a single analytical workflow and without the need of HPLC separation. Total elapsed time of the analysis was <1 minute for the samples and this technique allows the reaction to be monitored over time.

Conclusion
The Advion Interchim Scientific® ASAP-MS, with its rapid polarity switching and efficient and versatile sample introduction via the Atmospheric Solids Analysis Probe (ASAP®), empowers medicinal chemists to monitor reactions with confidence. The robust system ensures that no critical data is overlooked, streamlining drug discovery workflows and enhancing decision-making processes. Harness the power of dual polarity detection with Advion Interchim Scientific® ASAP-MS—because every detail matters in the mission of drug discovery.

Posted on

Qualitative Analysis of Oligonucleotides Using The Advion Interchim Scientific® HPLC-UV/MS System

Instrumentation
Mass Spec: expression® Compact Mass Spectrometer (CMS)
HPLC: AVANT®

Introduction

Oligonucleotides have gained significant attention in biopharmaceutical development due to their
ability to modulate gene or protein expression. Their clinical success is evident with the approval of several oligonucleotide-based drugs or their advancement into clinical trials.[1] These drugs include antisense oligonucleotides, small interfering RNA (siRNA) therapeutics, and mRNA-based vaccines, exemplified by the successful development of COVID-19 vaccines. Such accomplishments have spurred further interest and investment in oligonucleotide research and development.

Solid-phase synthesis is a commonly used method to produce oligonucleotide sequences. The raw material is typically purified through various techniques, such as desalting, ultrafiltration, solid-phase extraction (SPE), high-performance liquid chromatography (HPLC), or preparative liquid chromatography (prepLC), depending on the desired purity level. Ion-pairing HPLC or prepLC methods are often preferred as they offer higher purity compared to other techniques.

This application note aims to demonstrate the HPLC/UV analysis of multiple oligo samples and utilize HPLC/CMS analysis to determine their molecular weight.

Method

HPLC-UV/CMS System
With a quaternary pump and column selection valve, the process of switching between different buffers and columns for various analyses becomes remarkably straightforward, eliminating the need for manually
removing the column and changing the solvent. This automation greatly enhances efficiency and convenience in the analytical process.

Table 1: Item Instrument List


Oligo(dT) 12-18 primer
Oligo(dT) 12-18 primer (Thermos Fisher Scientific, MA) was used to check the HPLC method for oligonucleotides analysis.

The separation of these Oligo(dT) 12-18 primer was carried out using an ion-pair reverse phase HPLC method with an Interchim Uptisphere Strategy 5 μm C18HQ column 250 x 4.6 mm. A 10 μL aliquot was injected for all analyses, and the column temperature was maintained at 30°C. The mobile phase A composition was 100 mM TEAA in water, while mobile phase B is acetonitrile. And the flow rate is 1 ml/min.

The HPLC analysis proceeded as follows: After injection of the sample, mobile phase B was set at 10% for 1 minute. It was then linearly increased to 15% over 24 minutes. At 25.1 minutes, it increased to 95% and kept at this level for 2.4 minutes to clean the column. Subsequently, at 27.6 minutes, it reduced to 10% and maintained for 2.4 minutes for column equilibration.

Figure 1 illustrates that the HPLC method effectively separates the seven Oligo(dT) 12 to 18 primers.

Figure 1: HPLC/UV analysis of Oligo(dT)12-18


RNA Standard with 4 components
The RNA oligonucleotides mixture (Aglient Technologies, CA ) was prepared by diluting it 10 times with DI water before HPLC analysis. The sequences of four RNA standards are as follows: 14 mer (CACUGAAUACCAAU), 17 mer (UCACACUGAAUACCAAU), 20 mer (UCAUCACACUGAAUACCAAU), and 21 mer (GUCUCAUCACACUGAAUACCAAU).

The separation of these RNA samples was conducted using a similar HPLC method as that for oligo(dT)12-18 primers, with slight modifications.

The HPLC analysis proceeded as follows: After injection of the sample, mobile phase B was set at 9% for 1 minute. It was then linearly increased to 10% over 24 minutes. At 25.1 minutes, it increased to 95% and kept at this level for 2.4 minutes to clean the column. Subsequently, at 27.6 minutes, it reduced to 9% and maintained for 2.4 minutes for column equilibration.

Figure 2 illustrates that the HPLC method effectively separates the four RNA samples, even with a 1-mer difference between the 20-mer and 21-mer RNA samples. This baseline separation for the 20-mer and 21-mer is crucial for analyzing synthetic oligonucleotides, as most impurities during synthesis are typically N=1 mer or N+1 mer.[2]


ssDNA Samples
Three single-strand DNA samples (ssDNA) with 17 mer (GTCAGCAAGGACATCGT), 18 mer(CATTTGAGTAGCCAACGC), and 19 mer (GGACACTTTCATGCGAGTT) were also tested using the modified HPLC method from that used for RNA samples.

The concentration of each ssDNA was 30 μM, and 10 μL aliquots were loaded onto the column for analysis. The HPLC analysis was performed using the following gradient: After the sample injection, mobile phase B (MPB) was set at 9% for 1 minute, then linearly increased to 15% over 24 minutes. At 25.1 minutes, it increased to 95% and maintained at this level for 2.4 minutes to clean the column. At 27.6 minutes, the MPB was reduced to 9%, and this level was maintained for 2.4 minutes for column equilibration. The flow rate for the analysis was set to 1.5 ml/min. Despite the greater change in solvent B per minute compared to the RNA samples, Figure 3 demonstrates that the method effectively separates the three ssDNA samples with good baseline resolution.

Figure 3: HPLC/UV analysis of three ssDNA samples 1-3, three single strand DNA samples with ssDNA-1: 17 mer (GTC AGC AAG GAC ATC GT); ssDNA-2: 18 mer (CAT TTG AGT AGC CAA CGC) and ssDNA-3: 19 mer (GGA CAC TTT CAT GCG AGT T).


Purity Analysis of a ssDNA Sample
With a same method used for ssDNA samples shown in figure 3, it was also employed for the purity analysis of an ssDNA sample: 19 mer (5’-TGGCGGGCGTACCTGGACT-3’).

Figure 4 reveals that the 19-mer ssDNA 4 has a UV purity of 74.3% at 260 nm that was determined using Advion Data Express software.


MS Analysis of ssDNA sample used in F.5 purity analysis
The HPLC/MS analysis of oligonucleotides was performed using an Advion AVANT® HPLC system coupled with an Advion Expression® CMS-L. For MS analysis, the Interchim Uptisphere Strategy 2.6 μm C18-HQ column with dimensions 50 x 2.1 mm was used, with a flow rate of 0.2 ml/min. The column temperature was set to 55°C.

Compared to the use of TEAA for the mass analysis of oligonucleotides, the ion pair reagents combining TEA and HFIP offer significantly improved performance. Therefore, this application note will focus on employing TEA and HFIP ion pair reagents for the HPLC/MS analysis of oligonucleotides.

The mobile phase consisted of 15 mM TEA and 10 mM HFIP in water as mobile phase A, and methanol as mobile phase B. The total HPLC run time was 25 minutes, starting with 5% of solvent B for 1 minute.
The percentage of B was then increased to 6% over 14 minutes, followed by an increase to 95% at 15.1 minutes that was kept for 2.9 minutes to elute the compounds of interest. Subsequently, the % B was reduced to 5% and kept at this level for 6.9 minutes to equilibrate the column before the next analysis.

The MS analysis was conducted in negative ESI mode with the MS scan range set from 500 to 2000 Da. Figure 5b shows the MS spectra of ssDNA-4, displaying a charged envelope with peaks at m/z 1463.9 (4-), 1170.8 (5-), (975.8 (6-), 936.0 (7-), 731.8 (8-), and 650.2 (9-). Through charge deconvolution in Data Express, the uncharged mass for the ssDNA sample was determined to be 5861.8 Da, which closely matches the theoretical value of 5860.8 Da.

Figure 5: HPLC/MS analysis of ssDNA-4 (5-TGG CGG GCG TAC CTG GAC T-3), MW 5860.8 Da


Figure 6: HPLC/MS analysis of ssDNA-5 (5-GGGTGG-CAT-TAT-GCT-GAG-T-3), mw 5914.9


MS Analysis of a Further Example Sample
The MS spectra of ssDNA-5 (5’-GGG-TGG-CAT-TATGCT-GAG-T-3’) are depicted in Figure 6, showing a charged envelope with peaks at m/z 1477.8(4-), 1182.1(5-), 984.7(6-), 843.8(7-), and 738.2(8-). By charge deconvolution the uncharged mass for the ssDNA-5 was determined to be 5913.9, which is in close agreement with the theoretical value of 5914.9.

Conclusion

Using a 5 μm particle size C18HQ column coupled with TEAA (Triethylammonium acetate) ion-pairing reagent has been demonstrated to be suitable solution for oligonucleotide HPLC analysis.

For MS analysis of Oligonucleotides, the same C18HQ column can be employed with HFIP (hexafluoroisopropanol) and TEA (triethylamine) as the ion-pairing reagent in conjunction with an AVANT® HPLC-UV/CMS system. This method has been proven to yield additional accurate mass measurements of Oligonucleotides.

Overall, utilizing the Interchim C18HQ column and the appropriate ion-pairing reagent in combination with the AVANT® HPLC-UV and -CMS system can provide a reliable solution for the purity analysis and characterization of oligonucleotides.

References
[1]Roberts, T.C., Langer, R. & Wood, M.J.A. Advances in oligonucleotide drug delivery. Nat Rev Drug Discov 2020, 19, 673–694
[2]Martina C. et.al. Oligonucleotides: Current Trends and Innovative Applications in the Synthesis, Characterization, and Purification, Biotechnology J. 2020, 1900226

Posted on

The Extraction, Identification, Purification and Quantitation of Cyanidin-3-Glucoside in Black Rice

Instrumentation
Flash: puriFlash® 5.250, XS-Vap®
Mass Spec: expression® Compact Mass Spectrometer (CMS)
HPLC: AVANT™

Introduction
Rice is one of the more essential foods in the world, especially in Asian countries. Amongst the pigmented rice varieties, black rice has received increasing attention because of its high nutritive value and beneficial health properties. Black rice is an anthocyanin enriched pigmented rice that contains Cyanidin-3-glucoside (Cyn-3-Glu), Cyanidin-3-rutinoside (Cyn-3-Rut), Peonidin-3-glucoside (Pn-3-Glu) and other anthocyanins. Cyanidin-3-glucoside is the dominant anthocyanin in black rice.

This application note shows how Cyanidin-3-glucoside is extracted from black rice and purified with a prepLC/Flash system. The amount and purity of Cyn-3-Glu is measured utilizing a certified reference standard.

Method
Cyanidin-3-glucoside Extraction
Black rice was purchased from a local grocery store, ground into fine powder with a spice grinder, and extracted with the following method:
1. 30 grams of the ground black rice was mixed with 200 mL of methanol acidified with 1.0 N HCl (85:15, v/v) and sonicated for 15 min.
2. The mixture was centrifuged at 7500 rpm at 4°C for 5 min. The supernatant was decanted into a clean flask. The pellet was extracted again with 200 ml of methanol acidified with 1.0 N HCl (85:15, v/v), and sonicated for 15 min.
3. Supernatant from the two extractions was combined and reduced to 25 ml using a rotatory evaporator.
4. A small part of the concentrated extract was diluted 10x with water for HPLC/UV/MS analysis, the rest was loaded directly on a PrepLC/Flash system for purification.

Analytical HPLC/UV/MS Setup
Table 1: Analytical HPLC/UV/MS method for the black rice extract.

Analytical HPLC/MS Analysis of Black Rice Extract
The concentrated extract of black rice was diluted 10x with distilled water for HPLC/CMS analysis.

With mass range from 200 to 800 Da, HPLC/MS chromatogram is shown in Figure 1a. The average MS spectrum from the peak at 12.10 min is shown in Figure 1b with a single ion at m/z 449.2 detected in the positive ESI mode. The MS spectrum with in-source CID is shown in Figure 1c showing a confirmative fragment ion at m/z 287.0

Figure 1: A). The HPLC/MS Chromatogram of black rice extract, B). The average mass spectra of peak at 12.10 min, C). The average mass spectra of peak at 12.10 min with in-source CID at 30V.

MS Spectra Database Search
Through the MS spectra database search in Advion Data Express, the compound eluted at 12.1 min is confirmed as Cyanidin-3-glucoside (Cyn-3-Glu).

Figure 2: Library search result of the average MS spectra in Figure 1c extract.

Peak Express Software Helps to Detect other Anthocyanin
The Peak Express™ software implemented in Data Express can dynamically determine the rate of change of intensity and standard deviation of all ions being detected and only display the ions that exceed a preset threshold setting.

Peak Express™ helps to detect another peak at 14.41 min in the ΔIC chromatogram (Figure 3b) that is barely indicated in its TIC chromatogram (Figure 3a). ΔS Delta Spectrum with the in-source CID shows two ions detected at m/z 463.3 and 301.1.

MS spectrum database search determines that it is Peonidin-3-O-glucoside (Search result is shown in Figure 4).

Figure 3: A). The HPLC/MS chromatogram of black rice extract, B). The ΔIC chromatogram of black rice extract C). The ΔS Delta Spectrum of peak at 14.41 min with in-source CID at 30V

Figure 4: The library search result of the ΔS Delta Spectrum in Figure 3c

HPLC/UV Analysis of Black Rice Extract
The black rice extract was also analyzed by HPLC/UV. Two characteristic UV absorption peaks of Cyn-3-Glu at 12.01 min are found at 278 nm and 518 nm (Figure 5b).

520 nm is used to trigger the fraction collection in the purification with a PrepLC/Flash system.

Figure 5: A). The HPLC/UV chromatogram of black rice extract, B). The UV absorbance profile from peak at 12.07 min

PrepLC Method for cyn-3-glu Purification
Table 2: PrepLC method for Cyn-3-Glu purification

Purification
Black rice extract purifications are performed on an Advion Interchim Scientific puriFlash® 5.250 PrepLC/Flash system.

The detail information of solvents and separation method is listed in the method table. Typical PrepLC/UV chromatogram of the black rice extract (3 ml sample) is shown in Figure 6.

Each fraction collected is additionally analyzed by HPLC-UV/MS to confirm identification and provide additional purity analysis.

Figure 6: The prepLC chromatogram (520 nm) of black rice extract on puriFlash® 5.250 PrepLC/Flash system

HPLC/UV Analysis of Fraction 2, 5 and 8
All fractions are analyzed by HPLC/UV/MS. HPLC/MS analysis of fraction 1 shows an impurity with the m/z 611, and low UV response of Cyn-3-Glu. And fractions 2-8 have a purity of more than 97.6 %. The HPLC/UV chromatograms of fraction 2, 5 and 8 are used as examples shown in Figure 7 with purities of 97.6% for 2, 100% for fraction 5 and 8.

Except for the first fraction, all fractions were combined for dryness. The drying of fractions was performed on an Advion Interchim Scientific puriFlash® XS-Vap system at room temperature. The weight of Cyn-3-Glu purified from 30g black rice is 25.8 mg.

Figure 7: The HPLC/UV chromatogram of fractions a) Fraction 2, b) Fraction 5, c) Fraction 8.

Quantitation of C3G by HPLC/UV
To confirm the final purity of the dried sample, a certified reference standard of Cyn-3-Glu was used for the quantitative analysis of dry Cyn-3-Glu to check its purity. HPLC calibration curve of Cyn-3-Glu reference is shown in Figure 8.

The measured amount of Cyn-3-Glu is 25.5 mg with a purity of 99.0%.

Figure 8: HPLC/UV calibration curve of Cyn-3-Glu reference standard

Conclusion
With the developed HPLC/UV/MS and PrepLC methods, Cyn-3-Glu in black rice extract can be separated, purified, and quantified.

25.5 mg of Cyn-3-Glu was purified from 30g black rice with a purity of 99.0%.
Combination of Interchim PrepLC/Flash and Advion HPLC-UV/CMS is a simple and cost-effective solution for extracting and purifying Cyn-3-Glu from rice sample or samples containing Cyn-3-Glu.

Following this general workflow:

HPLC/CMS provides a simple way for the identification and purity analysis of target compounds in natural product purification.

Posted on

Purification of Bioactive Peptides from Complex Mixtures using the puriFlash® 5.250 PrepLC and expression® CMS Detector

Instrumentation
Mass Spec: expression® CMS
Flash: puriFlash® 5.250 prepLC
HPLC: AVANT®

Author
Changtong Hao
Advion Interchim Scientific

Introduction
In recent years, biopharmaceutical companies have increasingly embraced peptide/protein-based drugs due to their enhanced specificity and selectivity compared to traditional small molecule drugs. However, the purification of peptides/proteins during the drug discovery process is crucial to ensure the safety and efficacy of the final product. Attaining the highest possible purity levels for the bioactive target compounds is essential in minimizing the risk of toxicity and complying with regulatory standards.[1,2]

Whey protein isolate, a by-product of cheese production, contains various glycomacropeptides and two significant bioactive peptides, casein macropeptide A (CMPa) with a molecular weight (MW) of 6757 Da and casein macropeptide B (CMPb) with a MW of 6787 Da. Extracting and purifying individual components, such as casein
macropeptide, is essential for investigating their bioactivity.[3]

In this application note we use whey protein isolate and two casein macropeptides as an example to demonstrate the isolation and purification of bioactive components with a system comprised of a puriFlash® 5.250 prepLC coupled online to an expression® CMS detector. This combination offers higher selectivity and sensitivity compared to traditional detectors such as UV or ELSD, which may not effectively respond to bioactive target peptides and proteins.


Advion Interchim Scientific
puriFlash® 5.250


Advion Interchim Scientific
expression® CMS

Method
Preparation of Whey Protein Isolate
• The casein macropeptide isolation procedure used in this application is based on Tadao Saito’s work[4] with some modifications.
• A 50 g sample of whey protein isolate purchased from local grocery store was combined with 500 mL of a solvent mixture of 70% water and 30% methanol (v/v). The mixture was sonicated at 70°C for 90 minutes and then filtered under reduced pressure.
• The resulting filtrate was concentrated to a volume of 300 mL by removing methanol using a rotary evaporator under reduced pressure at 40 °C. It was then stored at 4°C for one hour. Subsequently, an equal volume of cold ethanol was added to the solution, and the mixture was vortexed for 5 minutes before being stored at 4°C for an additional 4 hours.
• The mixture was filtered under reduced pressure using a 0.5 μm filter. The final filtrate was then concentrated to a volume of 50 mL using a rotary evaporator under reduced pressure.
• A 100 μL aliquot of the concentrated extract was mixed with 900 μL of deionized (DI)
water for analytical HPLC/MS analysis.
• The remaining filtrate was used for peptide purification using the puriFlash® 5.250 PrepLC system coupled with an expression® CMS detector.

Table 1: Analytical HPLC/MS Method Setup

Analytical HPLC/MS Method Setup
The liquid extract from whey protein isolate was first analyzed using an AVANT® HPLC/CMS system and a chromatography separation method developed for the 4.6 mm column used (Table 1).

Figure 1a shows the HPLC/MS chromatogram of the liquid extract. The averaged MS spectra from the peak at 6.44 min indicates that the compound is a multiply charged peptide with at least five masses at m/z 755.2, 849.4, 970.6, 1132.1, and 1358.6 (Figure 1b) forming a charge profile.

Through software charge deconvolution, the uncharged mass of the peptide was determined to be 6787.4 Da, indicating casein macropeptide B (CMPb, theoretical mass of 6787 Da) (Figure 1c).


Advion Interchim Scientific
AVANT® (U)HPLC


Figure 1: (a) HPLC/MS chromatogram of liquid extract from whey protein isolate, (b) The averaged MS spectra from peak at RT 6.44 min, (c) The deconvoluted, uncharged mass of the peptide eluting peak at RT 6.44 min.


Figure 2: (a) HPLC/MS chromatogram of liquid extract from whey protein isolate, (b) The averaged MS spectra from peak at RT 11.02 min, (c) The deconvoluted, uncharged mass of the peptide eluting at RT 11.02 min.

The averaged MS spectra obtained from the peak eluting at 11.02 min suggest that the compound is also a multiply charged peptide with masses at m/z 751.5, 845.4, 966.1, 1126.8, and 1352.1 (Figure 2b) forming its charge profile.

Similarly, charge deconvolution determines the uncharged mass of this peptide to be 6755.3 Da indicating the A variant of casein macropeptide, CMPa with a theoretical mass of 6755 Da (Figure 2c).


Advion Interchim Scientific
puriFlash® 5.250, MS Splitter and expression® CMS

PrepLC/MS Chromatography
In a next step, the analytical separation method was transposed to the larger prep scale from 4.6 mm column ID to 30 mm ID column ID and further optimized for the purification of the two CMPs (casein glyco-macropeptides) on the puriFlash® 5.250 PrepLC/Flash system coupled online to the expression® CMS detector.

The PrepLC-UV/MS chromatogram of the whey protein isolate is shown in Figure 3 and parameters shown in Table 2.

Fraction collection was triggered based on the MS signal, chosen for its higher selectivity and sensitivity. XIC of 970-971 Da was used to detect CMPb, and XIC of 965-966 Da for CMPa.

The organic solvent in the combination of fractions 11-17 and fraction 18-22 was removed using a rotary evaporator under negative pressure, and the remaining aqueous
solution was dried using a LABCONCO Freezone 2.5L (-50 C) lyophilizer, resulting in a dry collection of 10 mg each, which was then dissolved in 10 ml of deionized water for subsequent HPLC/UV/MS analysis. The results of the purity analysis are shown in figures 4 and 6.

Table 2: PrepLC/MS Method Setup


Figure 3: The PrepLC-UV/MS chromatogram of two whey protein isolate

Results

Purity Analysis of CMPb
Purity analysis of CMPb in the pooled fractions 11 to 17 is shown in Figure 4. MS analysis shows that four major ions were detected with m/z at 970.8, 1132.3, 1358.6 and 1968.2 (Figure 4b).

With the averaged mass spectra from Figure 4b, the uncharged mass of the peak at 5.94 min was determined to be 6788.4 (CMPb, Figure 4c). However, MS analysis can also detect four minor components at 6758.3, 6773.5, 6804.8 and 6868.4 Da.

The obtained UV purity of CMPb is 86.7% (Figure 4d), but, based on the additional MS data, the compound purity is actually less then that (estimated 80%).

CMPa in the pooled fractions 18 to 22 was measured to be 94.7% (figure 5a) based on UV analysis of the analytical run.

The deconvoluted uncharged mass analysis shows the expected dominant mass 6756.2 of CMPa (figure 5b), and one minor component at 6774.6, an oxidized form of CMPa.

Again, this example shows the value of MS detection of bioactive compounds such as peptide and proteins, and the better specificity of MS detection compared to UV.


Figure 4: (a) The HPLC-MS chromatogram of pooled fractions of 11-17, (b) Averaged MS spectra of peak eluting at RT 5.94 min, (c) the uncharged mass from (b), (d) The HPLCUV chromatogram of pooled fractions of 11-17.


Figure 5: (a) The HPLC-UV chromatogram of pooled fractions of 18-22. (b) deconvoluted uncharged mass of CMPa.

The final overall purity is estimated to be ca. 90%, an excellent value for a bioactive molecule in drug discovery.

Further improvement in purity can be achieved with selective fractions – at the cost of yield. For example, the HPLC-UV/MS analysis of fraction 20 of CMPa (Figure 6a) shows a UV purity of 99.0% (Figure 6d) and no oxidized by-product in the MS analysis.


Figure 6: (a) The HPLC-MS chromatogram of fraction 20, (b) Averaged MS spectra of peak at RT 5.71 min, (c) deconvoluted uncharged mass of CMPa (d) The HPLCUV chromatogram of fractions 20.

Conclusion
The puriFlash® 5.250 PrepLC/Flash system, coupled on-line with an expression® CMS detector, achieves outstanding performance, facilitating the selective purification of bioactive macropeptides from a complex matrix with high level of confidence. Compared to UV or ELSD detectors, the mass spectrometer delivers superior selectivity and sensitivity.

An illustrative application of this approach shows the isolation of casein glycol-macro-peptides, resulting in a purity range of 80% (CMPb) to 90% (CMPa) through combined fractions with high yield. Even higher purity of up to 99.0% can be achieved with selective fractions.

 

REFERENCES

[1]Gräslund, S., et al. (2008). Protein production and purification. Nature methods, 5(2), 135-146.
[2]Biopharmaceutical Processing: Development, Design, and Implementation of Manufacturing Processes.
[3]Lin T., et al. (2021) Bioactives in bovine milk: chemistry, technology, and applications Nutrition Reviews v79(S2):48–69
[4]Saito T., er al. (1991) A new isolation method of caseinoglycopeptide from sweet cheese whey. J. Dairy Sci. 74, 2831-2837

Posted on

Blood Analysis using the Advion Interchim Scientific SOLATION® ICP-MS

Introduction

Trace elements are essential for proper biological functions in humans, and differing levels of trace elements are indicative of many diseases and conditions. Non-essential trace elements are also present in the human body as a result of environmental contaminants generated by human or industrial activities deposited in soil, air, water, and foodstuffs. These essential and non-essential trace elements are easily measured and monitored in blood, serum, and urine using ICP-MS.

In this application note we present a fast method for routine analysis of small volume blood samples for key toxic and essential elements using the SOLATION® Inductively Coupled Plasma Mass Spectrometer (ICP-MS) using a simple “dilute and shoot” sample preparation. The high sensitivity and wide dynamic range of ICP-MS are particularly important for the determination of trace levels of heavy metals, while simultaneously measuring nutritionally relevant elements at higher levels. Blood is a complex matrix, rich in proteins and salts that favor the formation of carbon- and chlorine-based interferences that affect many of the analytes. The collision cell on Advion Interchim Scientific’s SOLATION® ICP-MS is necessary for overcoming those interferences.

The SOLATION® ICP-MS has an octupole collision cell that is used for addressing interferences from polyatomic ions, especially for the transition metal elements. It is critical for robust and routine trace element analysis that the octupole cell does not become contaminated which could cause drift and unnecessary downtime. Ions passing through the interface are directed through a 90˚ turn and focused onto the entrance of the octupole using a quadrupole deflector (QD). Light and neutral particles continue through the QD and away from the cell.

The collision cell in the SOLATION® ICP-MS can be operated in “He Gas” mode in which the cell is filled with He to act as a collision gas, or in “No Gas” mode in which the cell is empty. The “He Gas” mode is used for isotopes subject to polyatomic interferences while the “No Gas” mode is used for the rest of the isotopes. The rapid switching between “He Gas” and “No Gas” modes on the SOLATION® (< 5 sec) ensures that analytical runs can be kept short, thereby improving productivity.

Experiment & Results

Reagents & Materials

Nitric acid (Aristar Plus, trace metal grade)
Triton X-100 (especially purified, Roche chemical)
Water, type 1 (18.2 MΩ, Elga point of use system)
Methanol (hypergrade for LC-MS, Supelco)
Mg, Ca, Mn, Cu, As, Se, Cd, Pb, Ge, Rh, Au, and Ir standard solutions (1000 μg/ml, Claritas ppt grade) 
Trace Elements Whole Blood L-1 (SRM1) (Seronorm)
Trace Elements Whole Blood L-2 (SRM2) (Seronorm)
Trace Elements Whole Blood L-3 (SRM3) (Seronorm)
Blank Whole Blood (WB(F)) (UTAK)
Acid diluent: (0.5% Nitric acid, 0.05% Triton X-100, 2% Methanol, 0.25 μg/mL (ppm) Au, and the internal standards: 10 μg/L (ppb) Ge, Rh, and Ir)

Table 1: Calibration and standard concentrations

Standards

The method was developed to determine Mg, Ca, Mn, Cu, As, Se, Cd, and Pb in whole blood samples. The elements were chosen to represent some of the commonly measured metals in blood, covering both essential and toxic elements. Standards were prepared using the acid diluent with elements at four concentration levels to cover the range typically seen in blood. Table 1 outlines the standard concentrations at each level and which elements are at that level. The analysis mode and the internal standard used for each analyte are in Table 2. The ICH guidelines call for a minimum of five concentrations to establish linearity; with the calibration blank we use six, satisfying this requirement.

Table 2: Analysis Mode and Internal Standards

Samples & Preparation

Samples were prepared in 15mL, metal-free centrifuge tubes. Acid diluent (14.7mL) was added to each tube, followed by 0.3mL blood sample for a 1:50 dilution. The tubes were capped and inverted 3-5 times to thoroughly mix.

The samples were analyzed using a SOLATION® ICP-MS. The SOLATION® instrument configuration for this analysis was a cyclonic spray chamber with a Micromist concentric nebulizer and a one-piece torch. Ni sampler and skimmer cones were used throughout the study. The running conditions for the instrument are summarized in Table 3.

Table 3: ICP-MS Operating Parameters

Results & Discussion

We followed the ICH “Validation of Analytical Procedures” guidelines for method validation which defines specific requirements for accuracy, precision (repeatability), detection limit and method detection limit (DL and MDL), and quantitation limits (LOQ). 

The accuracy of the method was established using the Seronorm reference materials, which had certified concentration values for all the elements in the method. These materials were measured in triplicate and the analytical results were compared to the certified values and 95% confidence limits provided by Seronorm. 

These values are plotted on Figure 1 where the minimum and maximum certified values are represented as a box. Our analytical values are plotted in Figure 1, and in every instance, our values lie inside the limits indicating a high degree of accuracy which easily meets the ICH specifications.

A second measure of accuracy is spike recovery. The “blank blood” (WB(F)) sample from UTAK was spiked with 150μL of the stock standard solution for all elements except Ca and Mg in the 15mL tube. The recovery is calculated as: 

Spike recoveries are shown in Table 4. All recoveries are within 90 – 110%, indicating excellent recovery of the spiked analytes.

Table 4: Spike Recoveries

Method precision is measured as the repeatability of six Seronorm level 2 (SRM2) samples. Six samples of Seronorm level 2 (SRM2) were prepared, diluted, and analyzed individually. The results show less than 3% RSD among the replicates. The %RSD of the six replicates is presented in Figure 2.


Figure 1: Accuracy of Certified Seronorm Material Analysis


Figure 2: Precision of Seronorm Material Analysis

The method detection limit (MDL), and limit of quantitation (LOQ) were determined using the standard deviation (σ) of the signal from eight acid diluent blanks. The acid diluent blanks were prepared using the same technique and equipment as the samples and were included at the end of each run followed by a calibration standard. The MDL and LOQ are calculated as: 

where S is the calibration slop, and:

Since the calibration slope was the analyte relative to an internal standard, the calibration standard was used to determine the counts/second/ppb. These values are calculated, multiplied by 50 to account for the dilution factor, and expressed in μg/L (ppb). In the table, the MDL and LOQ are plotted relative to physiological normal values represented by Seronorm 2 (SRM2). For most analytes, the MDL and LOQ are miniscule by comparison, particularly for the major elements calcium and magnesium. However, even for more challenging analytes such as selenium, the MDL is an order of magnitude less than Seronorm 2 (SRM2) which, despite being level 2 (SRM2), has the lowest selenium content of these three SRMs. 


Figure 3: LOQ and MDL as compared to physiological normal values
*as represented by Seronorm L2, formulated to represent typical, or average human values.

Conclusion

In this application note, we report on the analysis of trace elements in blood using the Advion Interchim Scientific SOLATION® ICP-MS. Blood is a complex and challenging matrix. However, these data support the use of a straightforward “dilute and shoot” sample preparation method that gives accurate and precise concentrations for high level and trace level elements in blood. Excellent recoveries were observed for both spiked samples and CRMs. The combination of the quadrupole deflector and the collision cell minimizes drift and ensures accuracy and precision over time. The reported method benefits from the fast collision cell gas switching capabilities of the SOLATION® to analyze a wide range of elements in blood for rapid, accurate and reproducible results.

Posted on

Analysis of Iohexol using the Advion Interchim Scientific AVANT® HPLC and expression® CMS System

Introduction

Iohexol is a widely used non-ionic imaging agent that improves contrast for x–ray analysis. Its low osmolality allows for a rapid clearance via the kidney, preventing reabsorption and further metabolization[1]. This makes iohexol a compound with a better safety profile compared to other imaging agents[2]. 

In many clinical imaging applications, imaging agents/contrast agents are administered to patients to improve the contrast and spatial resolution of the scan. Due to toxicity and side effects of imaging agent, preparations of their known concentrations and their purity analysis are very important for their safe use and accurate diagnostic. 

In this application note, a simple and accurate HPLC-CMS method for iohexol analysis is introduced.

Method

Method Setup

All solvents used in the application were HPLC grade.

Two Iohexol standards were obtained from Sigma Aldrich.

One was a certified reference material with purity of 99.99%, the second one had a stated purity of ≥ 95%.

All experiments were performed on an Advion Interchim Scientific® expression® Compact Mass Spectrometer coupled with an AVANT® UHPLC system with parameters as shown in Table 1.

Table 1: HPLC/MS Method

HPLC/UV/MS Analysis of Iohexol

At room temperature, iohexol will isomerize with two peaks detected in its HPLC/UV/MS analysis. 

These two peaks (Figure 1A) come from hindered rotation of the anilide N-acetyl group due to the bulky iodine atoms attached to the central benzene ring of the iohexol. Those two compounds are essentially “rotational isomers” that interchange slowly at room temperature in aqueous solution.

Both peaks are confirmed with MS analysis to show the same m/z at 821.9 (Figure 1B and 1C) and no difference was visible in their in-source CID mass spectra (Figure 2A and 2B). 

Since both rotamers contribute to the compounds toxicity and imaging enhancing capabilities in x-ray analysis, the sum of both peaks will be used for any further iohexol analysis in this application note. 


Figure 1: (A) HPLC chromatogram (254 nm) of iohexol, (B) The extraction ion chromatogram of protonated iohexol at m/z 821.8, (C) The averaged MS spectra from peak at RT 4.06 min.


Figure 2: (A) The averaged in-source CID mass spectra from peak at RT 3.61 min, (B) The averaged in-source CID mass spectra from peak at RT 4.06 min.

Purity Determination by HPLC/UV Analysis

By comparing the HPLC response from iohexol sample to the response of the iohexol certified standard at a similar concentration, the peak area ratio of sample to certified standard can provide a quick concentration and purity analysis. 

The equation to calculate the concentration ratio of iohexol is shown below:

The HPLC chromatograms of iohexol sample and certified reference are shown in Figure 3A and 3B.

The averaged value of summed two peak areas is 714 for iohexol sample (Figure 3A), and 740 for iohexol reference standard (Figure 3B). With the calculation of concentration ration, the calculated concentration of iohexol in the sample is 0.0964 mg/ml which equals a purity of 96.4% – in line with the stated product purity of ≥ 95%.


Figure 3: (A) HPLC chromatogram (254 nm) of iohexol sample (0.1 mg/ml) (B) HPLC chromatogram (254 nm) of iohexol reference standard (0.1 mg/ml).

Quantitation by HPLC/UV Analysis

To check the purity of an iohexol sample more accurately, a calibration curve of iohexol certified standard material was created with five different dilution levels from 25 to 500 μg/mL and with triplicate injections for each concentration. The R-squared value of the resulting linear calibration function is 0.9999 (Figure 4) showing excellent linearity. 

By way of the iohexol calibration curve approach, the purity of the iohexol sample was determined to be 97.5%. 

This value is also right above the stated purity of min 95% of the sample and differs by only 1.1% from the measured value by direct UV response ratio analysis of the iohexol sample to iohexol reference standard.

Both purity determination by way of a calibration function or by direct UV response ratio analysis can be used for organic chemicals with UV absorbances if certified reference standard material is available.

The calibration function method will provide a more accurate measurement.


Figure 4: Calibration curve of iohexol by HPLC chromatogram (254 nm)

Conclusion

The Advion Interchim Scientific AVANT® (U)HPLC system can provide accurate chromatographic methods for the purity analysis of imaging agents as shown for iohexol. Coupling UHPLC with the Advion Interchim Scientific expression® Compact Mass Spectrometer not only provides confirmations of target compounds via their mass and in-source fragmentation pattern, but also allows for rapid determination of impurities. 

REFERENCES
[1] T. Almen, Development of nonionic contrast media., Invest. Radiol. (1985) Investigative Radiology. 1985, 20(1), S2-S9.
[2] R.D. Moore, E.P. Steinberg, N.R. Powe, R.I. White, J.A. Brinker, E.K. Fishman, S.J. Zinreich, C.R. Smith, Frequency and determinants of adverse reactions induced by high-osmolality contrast media., Radiology. 1989, 170, 727-32.

Posted on

Extraction and Purification of 3 Curcuminoids from Turmeric Powder

Instrumentation:
Flash: puriFlash® XS520
TLC: Plate Express™ TLC Plate Reader
Mass Spec: expression® Compact Mass Spectrometer
Sampling: ASAP® Direct Analysis Probe

Introduction

Curcuminoids are natural polyphenol compounds derived from turmeric root (Curcuma longa). They are reported to have antioxidant activities1. Curcumin is the main curcuminoid found in turmeric. It is commonly used as an ingredient in dietary supplements and cosmetics, flavoring in culinary dishes, and a yellow-orange food coloring.

In this application note, a method to separate and purify 3 curcuminoids from turmeric powder using flash chromatography with the Advion Interchim Scientific puriFlash® XS520 Plus, TLC with mass spectrometry with the Plate Express™ TLC Plate Reader and expression® CMS is demonstrated. Fractions were identified using the Atmospheric Solids Analysis Probe (ASAP®).

Curcuminoid Extraction

The turmeric powder was weighted out (57.3 g) and transferred to a wide mouth glass bottle. Ethanol (250 mL, 200 proof) was added to the bottle and the mixture was stirred for 18 hours while covered with foil. The compounds of interest are sensitive to light. The slurry was then filtered and the filtrate was concentrated to dryness to form an amber oil (6.4 g).

Figure 1: Structures of curcuminoids.

Figure 2: Store-bought turmeric powder (left) and crude extract oil (right).

TLC/MS Analysis

The Advion Interchim Scientific Plate Express™ paired with the expression® CMS allows for easy identification of spots on TLC plates without the need for purification or sample preparation (Figure 3).

Initial TLC analysis showed 4 spots (dichloromethane:methanol, 97:3). The three lower spots were highly fluorescent, as expected for the curcuminoids of interest. TLC spots were analyzed by APCI ionization in negative ion mode. The bottom 3 spots were characterized by mass spectrometry.

Figure 3: Advion Interchim Scientific expression® CMS and Plate Express™ TLC Plate Reader (left) and close up of the TLC plate extraction head (right).

Figure 4: Developed TLC plate visualized at 365 nm. Resulting mass spectra of cur cumin (top), demethoxycurcumin (middle), and bisdemethoxycurcumin (bottom).

Flash Purification

An isocratic method was used as the separation shown on TLC was optimal as is. The crude material was purified on a 25 g, 15 μm spherical silica gel column (PF-15SIHC-F0025). A crude weight of 64 mg was dry-loaded onto 500 mg of silica gel and loaded into a 4 g dryload cartridge (PF-DLE-F0004).

Figure 5: Resulting flash chromatogram from developed TLC Plate.

Fraction Identification by ASAP®/CMS

The expression® CMS with the ASAP® Direct Analysis Probe allows for easy identification of compounds without the need for LC/MS or sample make-up.

The pure fractions (1.1, 1.3, and 1.5) were analyzed using the ASAP® probe with APCI ionization and positive polarity CMS. The curcuminoids ionize well in both APCI positive and negative polarity, however (M+H)+ ions showed less fragmentation. The detected masses are consistent with the theoretical [M+H]+ m/z values.

Figure 6: Advion Interchim Scientific ASAP® Direct Analysis Probe being inserted directly into the APCI-enabled ion source of the expression® CMS.

Figure 7: Mass spectra of fractions.

The purified fractions were concentrated to dryness to give solids I (14.1 mg), II (5.6 mg) and III (6.7 mg) respectively, which represents Curcumin (I), demethoxycurcumin (II), and bisdemethoxycurcumin (III) at 53.4%, 21.2%, and 25.3% of the isolated curcuminoid profile. These results are consistent with reported literature values2.

Confirmation of Compound Purity by RP-HPLC

Figure 8: UV Scan of purified fraction mixture.

Reverse Phase High Performance Liquid Chromatography (RP-HPLC) allows for a separate confirmation of compound purity after flash chromatography. An equal mixture of all three compounds was combined and run on a Phenomenex Kinetex® 5 μm Biphenyl 100 Å 50 x 2.1 mm column using isocratic ACN:Water (v:v, 55:45) with 0.2% formic acid. As expected, the elution order of the three curcuminoids changed order with now eluting III, II and I (Figure 8). After developing this method, the respective single collected fraction was injected and analyzed for purity and again confirmed by MS analysis.

Figure 9: UV Scan and mass spectrum of Curcumin Fraction 1.1.

Figure 10: UV Scan and mass spectrum of Curcumin Fraction 1.3.

Figure 11: UV Scan and mass spectrum of Curcumin Fraction 1.5.

Conclusion

With a combination of TLC chromatography, flash chromatography and mass spectrometry support at various stages of the process (TLC plate identification, fraction confirmation and secondary purity analysis), we can purify curcuminoids from Turmeric powder at confirmed purity levels of >95%.

References:
1Jayaprakasha et al. Antioxidant activities of curcumin, demethoxycurcumin and bisdemethoxycurcumin. Food Chemistry, Volume 98, Issue 4, 2006, Pages 720-724. ps://doi.org/10.1016/j.foodchem.2005.06.037.
2Praveen et al. Facile NMR approach for profiling curcuminoids present in turmeric, Food Chemistry, Volume 341, Part 2, 2021, 128646, https://doi.org/10.1016/j. foodchem.2020.128646.